Description :
From Genome Similarity Track
Location :
Scaffold_415:537612- 539099
Transcript NameFunction/comments
Aphin_H310_06296Hypothetical protein

Sequence
1487 bases(100 bases per row)
CCCAGAGGCGCGTGGGAATTTCCTTTCAGGAGCGTGTCTCTGGATGGCAGCTGGGAATTGTTTACTACAGCCGTCCTCAAAACCCGGGTTTTTGACCTAA
TACCGGGTGAAAGAATAACAATGTTGGTGTTTCCATTGATATTAAAGTCAAGCTTACGTATCGCCCCACAGTGTCGTAAACATCTTTTACCCGCGACGCG
TTTTTCGCGACATGATCGCGTCGTCGACTGCCATTTGTCAAGATGAAGGTGATCACGGACTGTCCTGCGCTCTACGCCGCTGTCGCTGTGGGCATCATGT
CGCTTGTCGGTGTGTACTACCTCCGACGTGGTCGTACGAGACGTCGCGCTCCTATCGCTGTCGACGTCACGCTGACGGACGACGAACTGGTCAAGCAAGG
ATTTGCATCCAAGAAAGTCCCAGACGATCTTGACGTGATTGTGATCGGGTCGGGGATGGGTGGGTTGACCGTTGCTGCCGCGTTGGCGAAAGAAGGAAAG
CGCGTTCTAGTGCTGGAGCAGCACGATGTCGCGGGTGGCAACACACACACGTTCGAGGAAGGAGGATACGAATTCGACACGGGGTTCCATTACATCGGAG
GGTTCCTCGACGACAAGTCATATCCGAACCGAAAATTGTTCGACTACATTTCCAACCACTCGGTCGAGTTCCAGCGGTACCGCCATCCCCGCCGCTCTTG
ATCTTCATCGGTTGTCGCTCATGGAGCTGCCTTGATAGATCGGGTGATACTGTCGACGTTGCCGTTGTCCAAGGGCCCGACGGTACCCGCGACGCTATCC
ACTTCACTGCCGACCACGAAGCGTTCAAGACCTACTTAAAGAAGCGGTTCCCTCTCGACCACGCCTCCATCGATGCGTACTTCAACGCAGTCAGAGCTGC
CAATCGTGGTTGGGAGGTCTTCTTTGGGTTGCAAATGTGTCCGACGTGGCTGCGTGGCGTGTACCGGTGGTGGAATGCGTCCAAGCTTGAATACTTCCAC
AAGACAGTCCTCGAAGTTGTGTCTTCGCTGACGACCAACGCGGAACTCCTCGGCATTCTCAACTACTCGTGGGGTGACTTTGGGGACCCGCCGTCCCGCG
CCTCGTTTGCGTTGAACGCAGCGATTCTCAACCATTACCGCGGCGGTGCGTACTACGCCGTCGGTGGCCCCAGCGTCATTCCCAAAAAAGTTGTTCGGGT
TATTGAATCCCATGGTGGGAAGGTTCTCGTGCGGGCGCCTGTGTCTGAGATCCTGATTGATGCGTCCAACAACGCTTTCGGCGTTCGCGTCAAGGGCAAA
GACATCCTCGCTCGTACCATCATCAGCACAGTCGGCGCGCCCCAGACGTACGCAAAGTTGATTCCGGAAACGCACCGCCACCACGTGGACCATCTTCTTC
GCGAACTGGCAAACCCGGCAATGCAATCGTGCTGCTCGCTCATGTCGCTCTTTGTGGGCTTTCGTGGGGACGCCAAGGAGCTCGACT