Description :
From Genome Similarity Track
Location :
Scaffold_20:537500- 538931
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G007849Similar to WDR77: Methylosome protein 50 (Pongo abelii)
Pytul_DAOMBR144PYU1_G007848Similar to Embryonic protein DC-8 (Daucus carota)

Sequence
1431 bases(100 bases per row)
GGACGTCTCGTCCGTAGCTGCTGAGTTCTTGTCACTCTCGTTGCCATCGTCCTGCTTGCCGCCAATGCCTTGCTGTGGCACAAACATGAAGTCGCTCTGT
GGTGTAGTCTTCTCAAGGCGCACGAGCTGCACGTCACCATTGTCGCACGCAAGCGCAAGAACATTGCCATCGACGCCACACCACGCGAGCGCCGTGACGC
CTGTCGCGAGGTGGAAGCCGCACTGGTGCGTGTGGGTGACGGCATCGACGAGCGCCACGCCGCCGCTCCACTGGTTGCCTTCCAGGTCCGAGTACGCGAC
CGCAAGAAGCGGCGTCTCGCCGCCAGCGCCTGCGTCGTCATCTGGAGACGTGAGCGGGCGCGCAGTGTACGCGACGGCGTCGATCTGCGCCGCTGCGGCG
AACACGCCCCGCGGCCGCAACTGCATATCCGCCACCACCATTTTGGCTTTACCCTTTTTGCGCTTTTGACCGTAGCCAAAGCCTATAATGTTGGCCTGAA
GTAGCGTGGTACACATTATATTCGATACATATGGATTGTGGCCTTGAATAAGGGTCCATTGGATCCTGAACGAGTTGTGCACTGTGAAAGGTTGTTGACT
ATGAGACGTTGTTTGGCTCCATTTTCTTCAACGCTGGCAAGAAGCTACGCATCCACGTTCACAGGCGCTTTGGCAGCCATCTAGATTGAGAGGACCCCAT
TGTTCTTCAACATGCATGCACATAGCCACCATCTCCATGTTCAAGCAGCTTAGGAACTCGAAGAAACGGTCTGCCAAAAGAACAGTCCAAGTTACTGGGT
AGCATGCTTACAAGTCACCTATAAAAGTACATAGATGTAGTAAAGTGACAATTGCAATTGATTATCAACAGCTACAAACTTATCCAAGTTGATCTTCAAC
ATAGTATATCCCGGTTAAATCGATTCAAAAAGCGCCGGGCCTTACTCGTAGTTGTTCGACAGTGACACAAACATTTGTAGCTCTTGGGATGCAAGCGTTA
TAAAATGGAAGCCAATGGGGATATGGCAGTTGGAAGCCACAAGCACATACGTCGCGCCGTTGCCGCTCGCTTGTGCAGCCCCCTGTCGCGCACCTCCCAT
GGTGTCACTGCCTGTCTGGTCCACGCGCAGGGGCAAATGCAGTGTCTTTAACGTCACTCAGTCTGCAACACACCACGGCGTGAAGAAGTGGCGTCTTGCA
CAAGAAGCAACACGAAGGCGCAACGCGCGAAAGCAACACGAACAACAAGTTACAAGCAATCATTGAACGCACAAGACAAACATGTCGGGCCGCATTTACG
AAGAGTACCGTCGCCGCGATGGCCACGGGTTAGACGATATGGCGGAGCGCCGTCGCGCCCAGATGGACGAGATGTACGAGCACGGCCGCGGCAAGGCCCA
AGATACCGTCGAGCAAGCGCGTCACAAGCTT