Description :
From Genome Similarity Track
Location :
scaffold_75:53748- 56926
Transcript NameFunction/comments
g2847.t1hypothetical protein

Sequence
3178 bases(100 bases per row)
GTCACGTAGTGCTGCTACCGGGAACGGGAGAGCACGGATTTCTGCATCGGAGGACATCCATTGCTATCCCACTGGCAAAGCAAGGGGTTGCCACACTGGT
ACGTTTGGTATACAGTCACCGACCGTAGTTTTATTACTGCATTTCAGTCCTTGACAGTTGCATGCTGTCACTGTAGATTCTGGAAGGACCATTTTACGGG
AAACGCAAACCGCCGCAGCAAAAAGGATCCAAGTTGCGAAGGTATGTTGTGATAGACTTGTTTTGCTAGTAGAAGTAGAACTGAGTGGGTGTTTCTGTGC
CATAGGGTAAGCGATCTGCCAATATTGGGTCAAGCAACAATCGAGGAAGCCAAATCCCTGTTGGAACACTTTCGAGATCATCACGGTTTCTCTCAACTAG
TGGTCGCAGGCAGTAGCATGGGTGGGCTCCATGCTGCTATGGTTGCTTCAGTGTTTCCTGGTGACGTTGGCGCTACTGCTTGGCTAGCTCCACCCTCGGC
AGTCCCCGTATTTGCTGATGGATTGCTCTCCGGATCCTGTAACTGGCGCTCACTTTACAAGCAGCACGAGCTTCAGATGTTGGATAAAATGCTGGCTGGA
CACGCCGTGGCTGAATCCTACGAAAAACTTACCGACGCTGTTGCTGACAGTGAGGAAGAGGGAGCTGGAGCTCCTGAACAGGAGATCGACCCAGTTCAGG
AAGCTAAAAAACGGATGAGGCTATTTCTCTCGATCACAGATATCGACAATTTCTTGCCTCCGCGACGATCAGATGCTGTTGTTTTCGTATACGGCACTGA
AGACGAGTACATTGGCTTCACTGAGCCACAGTGGCATGTACGTTGTGATCTAAGCTCATGCCTGCGTAGATTTACTAAGTTTCCCTTGTTCTTAGCGCAT
GCGCAAACAGTGGAAGCCGGCGCACTTCCGTACGATCAAGACAGGCCACGTTACCGGCATTTTACTGGAACAAGAGGCCTATCGCAAAACGATTTTGGAA
GTCGTTGGACTGTTGAAGGAGCGAGAAGCATCAACCGCGTCTACCTCCAAGTGAAATGCTAATTGAAAGCATCAAGTACTGACAAATGCGCACGTGCTGC
GACTGAATGACAGGTCCAGCGACTGCCTCGAGCTAGATTAAAAGCTTGTACCATTTTTTAACTGAGATCTGTGAACATGTAATTCATCCTTTTCACTCGT
GAAGACAGCAGACGATAATGTCCTGATACGTGCTCATGACCGTACGGAGTTCTCCACGCGATAGATTCTCTCGCCACATGATCTCTTCAATGTGGTGTTC
TCCGTGGAAATACACACATAGTCGCTTGAAAAGCGTAAAAACTGGATTGGGTTTGGCAATCTTGGCCAGATACGCGCGCTCTTGGTCTGTAAACAGCAAT
TGGCTAGCGACGCTCATCACTTGCGCCATTGGAACTGTACTACCTCCACGTGTGTCTGCAGCAGGATTCTCCTCGAATGTTGCCTGGGGAGGTGACGGAG
CTGCTGCTGCTGGATTCATAGGCGGAGTCTGCGCAATTGGCATACTACCTGGTGCACTGGTGTTCGTAGCACTGCTGCTGACTCGTTGTCGACGGAAACT
GGACGCCATGAGAGCAGGAGAGGAACTTCCAACAGACGACGCTCCTCCATTTCCAAGTTCTGCTGCGTAGTCTCCATCGGAAGGGATCATAAAGTAAATA
TAGCGATGGAGCTGCACGATAAATCGTTGCTGAAGCAGCCAGATGAGCATGTGAATGTACTCCGTCTTCTTGGCAGTCGACAAAGTCTTCATGTACTCGC
CAATACGACGAGATCCCGAAAATGTGGATAAAACTTCGCCCAGTTCGTAAGGTGCGAATTTGCGTCGAAACTCCTGTGCTAGTGGCGAGTTAATGTGCAG
ATCAGCCTTTGCGTTGACTTGATAAATGTTGTAGAGGGTAATTGCATCCACGATCCGGCCGAATCCCCAATAGACGAGGTGTGCGGCTAGTCGAAAGACC
TGATGGATCGGTACCCCAGCCTCCAGTGCGATATCCTGGAAACTCTTCAACGGATTCACAGCTTCCACAAGATCTCGAAGTTGACGTGCATGGTCTGCTG
GAAGCTTATTGAGGATATGGTCCTTGTCAGCCAGTAGCAGAAGCGTGTGGTACGGTCGCAAGCTCGCCATTCGGACTGTAACAGCGTCCGTAAGCGTCAG
TGATAGCTTCACCCAGCCATTCAACACCACGTGAGCAGCTCCAGACTCCTCCAGACCATGAAACACCCGTTTCAAGTCATTAGCCAGCACACTCTTCCCC
AGTGAAACATCGATTAGGGTTTGTGGATCCACCTCGACCGCCGACGACCCGTTCTCCCCGTCCTTCCTGTGATGATGATGATGCATCATACTCGACCCAC
TCGTTGCTGCAGTCGCTCCTGCATTGCTGGTAATGCTGCTACCACTCGTCGCTCCGGCTGCAACTGCTGCACTCACACTGTTTCCGCTTGTAGCACCGGA
GATCCCAGTGTTGGTATTCCCAGAATTCCGTTCACTCTGTGCCAGTTCGTCCCTCAACTGCAGCAGTTCCCTCACTTCTTTCGACACAAAACCCACTCGG
AGTTCCTCATGTAGAAGCCCATTGGACAATTGAGCTGCAACTGTATGGAAAGCTTGCGCACTGCTCCGTCTTCTGGCCAAAAGTTCCTCTTCACCAGCTT
GTTGTAAAGGAAGCAACTGTGTATCCATGGACCCATCCAGAGCTTCAGCAGGTCTTGTTACTTGTAGAGGACGGTCTTCCAGAGCGAAAATGATGTTGAA
CATAGTCGTCTCGTTCCCCGTAGTGGCAGTAGAACTGTTGGTAGATTGCTCTACAACTGTAGGTGATGCTCCTACAGCCGATGTAGAGCCGTTTGTCGCC
GTAGAACCAGCCCCCGGGCCGTCCGCTGGAGCTGCAGCTGGTAACCTACGCGACACAAGCACCGGGTGGCTCACGAAGCGCAGATCGTCCACCACAAGCT
CGAAACTAGCGTTGCAGAGTGCATTCTTGGGCCGGAAAAGCTTGGCTAAAAGGGGCGCTGGAAGCGAGTGGAAGCTGGACACGTTCTCGCTCGGAGGAGC
AGGGTATCGGAAGGCCAAGTTGCAGCCCTTGCTGATGTCGTCCACCACCAGCGCAACGCCTAAGAGGCGACAGCCGCC