Description :
From Genome Similarity Track
Location :
scaffold_15:537447- 546491
Transcript NameFunction/comments
g1467.t1hypothetical protein

Sequence
9044 bases(100 bases per row)
CTTCACTCGGCACCGGGACGAAGCACCTTCGTAGGACGAGCTGCTGCCGACGCGGAGCCCTTGAGCACGGTGTGTTTGCGCTTGCGCAACTGCTTGGTAC
GACGCTTTTGCTCGTTCTTCTGCATCCGGCGCTGGGCTGCCCGCTGCGGGTCGGCCACTGCTTCGGTGCGGCGCTGAAGTTTCCGTGCGGCGCGACGCGA
CGCCATCTTCCTCTGCACGAACGAGTAGGCCTCCAAGAACGTCGCCGCTCCCAGCTTTTTCTCCAGAAGCTGCAGCACTTCCTGCGCAAGTAGTGCGCTC
TCAGGTGGTGCCACGGACTCCGGTGCAGGACCGCTCCTTCGGTTCTTGTAGCGGTTGCGCTGTTGTTGCTGCAACCGCACCTGCTCCTGCTGAGCCTGCA
GCTCTTCCAGCTTGCTTGAAGCTCGATACAGCGGATTGATGATCTGAACAACATACTGCTCGGCGAAGGCCGCGTCGTGGCTGTGCAGCAGAGCGGCGAA
CAGCTTGAACACCACGGCTTGCACCTCGTTGCTGCAGCTTGAGCCGCGTGCAACGTACGAGAGCCGCGTAAGCAGCCAGCCCATGGGTGTACTTGCCTTT
GCGCGCTCCTCGGTCTTCTCCTGCTCCTCACGACGCTGCAGTTCCGCCTCGTCCTCGTCAGCCTTCTTCTCATCAGTGGCAGTGTCCTCCTCATCCCCAC
CCGCATCCTCAGCTTCGGCTTCAACTTCAACGCTTGTGGCATTCGCCTCGCCATCCTTCACGGAGTCAGCAGCGGCAGCCGTCACGTCCTGCGGGATATC
GGTTGTCTCAAGCGCTTGGCACAGGAACGGCAGCGCTGTAAGAACCTCGCTAGTTAGCTCGCTGTTCAGTGCCGGTGCCTCCAGCAGCTTGCAGAAAGCA
CTAGCCCAGATGAACAGACGGCCAGGACGCTGCAGATACAGCGCTCCATTCTGCAGACGCTCCAGGGCATCTCCAGATAAACGCTTCACCGGAGCTGCAA
AGGCAAGCGTGCTCGCTTGGCGGCGGCTCAGATACGACGTCAACAATCGGGTTGCGCCAAGACGCACCCAGGCGTGGGGGTACTGAAGCAACGGCAGCAC
CACCGCGTCCAGGAAATTCGTCGACACCTTCAACTCCTCCAGCCAAAGCTCGTAGGGACCAGCAAGATGGTCGCTGAAGGCTCTAAGCGCGACACAAACA
TGGTATGTCGGCTGCCACCGCACCTGATCACTGTCCTCCACAGTCTGAAGCTCATGTAGACTGCGCTCGAGCGCTGTGCGCGTCGCAGCCAATACCTGAG
GCGCGCTGCGCTCCATGAATTCGGGTCGGGTTTCCAGCACAAGCGTCGTCACCTGAGCTGCAGCCCCGAGTAGCTTCACCGCATCCGCAGTATTCGAGTT
TGCTGCTTGTGTCCACCACGTGCACACCAGCAGAATGCTCTCGTTCAGCTCCTTGTTGCCAAGACGACGCACAAGCGTGCTCAAAGCTGCCCGAGCCAGG
TCACGGCACTCCGAAGCCTCGTCGTTTGCTAACCGTAACACCAGCGGCAAGAAGAAGAACTGGGACCGAGCGTTCACCAAATCCTGCGGGAGCTTCGTGA
GAAGCGAACGAAGAGCCTCAAGTACGGCAGCGCGTCCAGTAGCGTGTCCGTAGCTCAGGTTGTCCACCAAGAATTTGAGGTGACGAGACAACCGCTTGTT
TCCAAGAGGGTACTCAAGCAGGAATGTCTGGTAGATGGTTGCACAGTTTAGGCGCGCACCCGGGGCATCGCTCTGAACAAGTAGCTCGCCAACACGCAGC
ATCACGTCGTACACCTCGCTCACCACCAGATGAGAGTTCACAATGGCCTTCAGAAGGGCGAATGTGGCGTTCTGGTGATCTTGCTCGTCAAGATCGGCTC
GCAAGAAACTCAGAAGCACGCGAAGTTGCGGTTCCGTCAGACGCAACGCCTCGTTCTTCGAGTCCTTGGGCGCGTTGCCGTTCTCCTGTGCGAGTTCCAA
TCCTTGCTGTTGTCTAAGGAGCGCAGTAAGGGTGCGGTAGCATGTCTGCACCATCTCGTTGCGAGTAGCAGCTCCAGCCTGCTGCAGAATCTTAAAGAGG
CGGTCAAGAAGAGGTGTGCGCGCCACCCGCAAAGCAGGGAGCTCTTCCTGTCGAGGGAGCATTGAGCCAACGCACTTGAGCGCGTTGATAACAGCTCGGT
CGTTCTTTGACTCGCCAGCGCAACGCATCAGCAGAGGCACAAGCGGGTCGACGAGCTGGGCCGGAGCGTCTGAAATCTTCTCTGCGTCTTGGTTCTTGGA
GCTGCCACTCTTGCGGAGGAAGGTGAATACCAAGAAGACACCAAAGTTTAGAAGCTCTCTCAGATGAGCGGTGCTCTCGGCTAGCAGAGCAGCAATCGCC
TCGCGCTTTTGCTTTTTGGTCTTGCTTTGCTGTTGCTGGCGCAGTTTATCAAACCCAGTGACCTGTTGCTGCATCGCAACACGTACAGTGTCCCGGGCTT
TCACTCGTGCGGCAAGCAGTTTAGTGGCTCGCGCACTCTTCTCGGACACAAGCCACGAAGTCACCAGTGCCGTGCTGCTACCTGCCGCTTCGTATTGCTC
CTTTTCCCTCTCTGAAGTCGGGCGCAAACTCTCCAGGCTCGAGTTGAGCACATTGTACGCGTAGAGGAACATGTAGGACGATTCCACAGAGGGGTTCTTC
GCAAGGCCAATCGCTATGCGCTTCAATGCTTCCTGCAACGCGGCCGTAGCTTGAGCCCCAGCGTCTGTCGCCTGGAAGCGCTTCACAAGAGCACTTACGA
CCTCGTGGATGCTTGGATTGGGCAAGAACGGCAATGATCTTGCCAGCAACTCCAGCGAGTCCAGGCTTCGCCCACCGCTCGAGCGGGCCTCCTTCATCTT
GGATTTTTGAGCCGATCTCCGTTCCACGCCTCCAGCAGCAGCCTCCGCGGCCTCGCCGATGGTAGTCATACCCTGGAATAACTCTGCGGCGAGAATCTCC
ATCAGGCTTGGCACGCAAGCATCCAGAGGGGATGCAAATTCAGCCTCGCTCTCGGCTTCCTGCTGCTTGTCTTGCATAAGCAGCAATGATTGAGGCTTCC
GAGGTGGGCCGGCGTGTCCTTCACTCTGCATGATCTCGGGGAGCTTTTCCAACAGGGCGTGCACCGTAAAAGACAGCACATGGACCATGTATCCATCGCG
CAGAGTGTGGCGAAGCTCCTCCACAATCGGTAGTAGGAAGCGTGCACCAAGCTCCACAGCGATTCTAACCAGCGTGGTACGAGCTGAAACACGCACAGCT
TCATCCTTATTTTTCAGCAAGTTCGCGAAACGCAACAGCAGCTTGGGTAGCTCACGTTGGAAGGTCTCAGCCCGCAATCGCCGCAGCACCTTCACGACAG
CCAGCGCGAGAGGCACACGGACAGAAACAGACTCCTCGGAGAGCGAAGATGGCTCGCTATCGTTCTCCTGCTTCTTCGAGCTCTTTTTCGAGCCCGCACT
CTTGAACAGATACGAGTAGAGCATCGGAAGAACTTGTGTCTCCATGTTATCCTGCACCTTGGAGGATCCGTCTTCATCTTTCTGCTCAGGCTCGGAGGGG
TTGCTGTCAGTGTTCACCTTACTGGACGACAATTGCCACTGAGTAGCCGCACCCGGCGCCTCGAAGTGAAAGTGGTCAATCACTGCGCAAATGGACATAA
TGATAGCGCCTTCCATTTCAACATGACCGTCGATCGACTTCAGCAGTCTGCGAAGCAGTGACAGGTAGTGCGACCAGCTCAACAGGCCAGCAGCACTGCC
TACGCACGCTGCAGCTTCAGCGCGCAGAGATTCCTGGCTCTTTGCGTGTGTCTCGTAGACAAAGTGCAGCACCAGAGGGAGGATGACACCATTCACCGTC
GAGTTCGAAAAGCACACAGGTTCTCCAATTTCCTCACCATCAACTTGACCCTGGGCCTTACCAGCCATGGAGTCCATGAGAGCGCTGAGACGCTGAAGGG
CACGACGTCTGCGGTGAGCTTGAATGTGCGTAATGTTGTAGAAAAAGTCAGCCTCTGGGTCCTCGTGGTTGCGCGCCAGCACCAGATCTGCTGGAATAAA
TGCAAACTGTCTAAATGCCTTGTGTTGGTCCGCCAACGATCCCAACAGAGTCACAAAGCCTCGCCGCGCATTCTCATCAGTCGAGCGCAGACTTGCCCGC
ACGCAAGGCATCACCAGCGACTCCAATCCATTAAGCACAGGAGACTTCGCGGCATCGTCTTGCCTGCTCTGCTCGACTGCAATCTCTGCTGCTAGTCCCA
GGAACACCGTAAGGCTGGCAAGCGCAGCGCTGCGCACTGAGAATTCAGCGTTGTGCATGGACTGCAGGCACTGCGCCACCAGAGGAGCTAGCAAATGAGT
CTCGTGCGTAAACCCGTCAAATCGTGTGGTGTTAAGGCGGTTTAGCGCAATCAAGCGACGCTCGTAGTCGGTCTCCTCGATTTGCTTAGCGTCGTATGCG
TTGAGCTCATCCAGCAACTCTGCCACGGGCGCCAGCTCTGTAAGCGCAGGATGCGCGCCCAGAGCTGTAAATACCATTACTAGTTTCAGGCGGGTATCAC
GATCGGCAATGCAATTCGGACCTGGAGCCAGCAGCCGTGCAAGGGCGAGCACATGCTTCTTAGGCTCCGAGAGCTTCGGCACCAAGTGGGCCAGCACCTC
CAATAGGTTTTCCTTGTCCTTAGGCGACGTCTGGTGGTTGCGCAGCAAGAATGGCAATAGCAGCTGAAACAGATCGTGGGCAGCAATTGCCACGTCTCCG
TCAGAGGCGTCTAGATGGTGCGACAGCCGGCAGAGGAACGTAAGCTCCTTTCGAGATGATCCAGCGTACCGGTCGCTTGCGTAGCGTGCAGCCTTGGCCT
GGAACCGCTGCACAAATTGCTCCAACACGAAAGGGATGTGGCTCACTAGCAGCACCTTGTCATCCTCCTTGATGGCAGTCATAGCCTCGTCTTCGGCCAA
CACACTTTCATCTCCATCCAGCAATGAATCCATAAACTGCAGGATAGAGTCTAGAATTTCAGGCGAAATGCCACGACTAGATGCGGACGACACGCTCGAT
GACGTCAATCCTGCCGACAAGCATGAGATAACGCTTAGCACCAGAGGCTCCGGGATCCACTGACGTGCCCTGTCGGCGCGACCCATTGCGACGAGGAATT
CCAAGAGTGCGGAAGCCTTGCCAGCACCGACAACCGCGTTGGACAAGTGCACAACGGCATCATGCGAAGTTTCCAGCACCGCTTCTACCCAGGGTTGGAG
GCGCACGAGCGTATCAAACTTCATTAGCAAAACATAACAATGGTTAGTACTTTAATTGAACAGTGGATTTGAGAAACCAAGCGCCGTACCGTGTCGATCA
ACTCTGCGAGTCGGCGGTATGTCAGCATGCGGATCTGCTTCTTCATCGAAGCAGATGTCACTAGGCTGTCAACAGTCGACGAGGGCTCACCAGCTTTCCG
CTTCGTGCCCACAGCAGCCCCTGCGTCCTCCTTGTCATCATTATTTTCGCCAGTAGTAGCAATTTCATCGTCATCTTCGCCGGAAGCTATACTGATCTGA
AGAATAGCCAGCAACACGTCTGCAAGGCGAGGCGCAAAAGCGGCCAGCTTCACGCCAAGTTGGTTGATAAGGTCCTCGAGCAAATTCAAGAAACCAAGAA
TGCGCGAAGGCTGTACATTGGAGACTGCTACGACAGGTTTCACGTTGTCAGAGATAATAACAGTGTCTTGAGCAAGACTCTCCGGGGCTTCAATCGATAC
ATCAAACGCACGGACCACAAGTTCCACGAAGCTCGCTAGCTCGGGCGCCTCCAGCGCTGCCAAATATGCTAAGATGGCTACACGGCGCGCAGCCACCGTG
TCACCATTGTTACGGCCCTTCTTGCTCACGCATTTCGAGTACAAAACGCGCAGCAGAACAGGGAGCAACTCAGGTCGGTGCTCGCGAAGCACAACCCCCT
CTCCGTCGCCCACCTTAAAGCTCGCCAGTTCTTCGCGGAACGACGAAGAATCCGTCAGCCGATTCAACTGCGTCTTGTAGGACACAACTGCCTTGTTGCC
AAACGCGTAGATGCACTGCAAAGCAAGCTTCGAAACCACTTCGTCCGACTTCATCAACAGGTCGAAGAAAAGAGCATGCAGCAACTGCTGCCCGTATGCA
CCTTTCATATTGTGAAAGACAGCAAACAGCTTCAGCTGATCAACAAACTTGCAACGCACTTCCTTGGTGGTCAAACCTTGGAACTCAACTGGCTTACGCC
AGTTTGGAGATGCAGCATCATTCGAACTGTTGGTTGTTTCTTCGAGCTTGACAAGCACCTGGTCAATTTCCTCGAGACGGTTGGCGTCCAGCTCATCCGT
GTAGATGGCGCTATACTGGTCGCGCAAAAATGTAAGGAAAAGCGGTACCATAAACTTGGTTTTGGCCTCCACAAGGTCCGCGAACTTCATAAGTCCCTTC
CACATCAGCGAATGATGAGTAGGAGCATCTGTGACACTAGATACATGCACCTTGCCCTGCTCCAGCATGCACACGCGCTCAAACTCCTGAGCAACGCCAC
TTTCGATACCAGACGTGCTCGATTCACTACCATTCGGGTCCTCGTGGCAAAGTGAAGCGGCAAGAAGCTCTGCACTGATGCATGGCCAAAATTCGTTGAA
ATGCAGCCGTGCTGCCGTCTCCACTGCATCCGCGATGTGTGGCCAAATCATAGAGAACTTGACGTGGTACAGACCCAACAATTGGTTCAAGGCAATTTTC
TTGTACAGCTCCGGGGTCTGTGGCGAACGACACAGGATCTTCACTCGGGTCAGCAGGCGCACCACTTCTCGTTCAGTAGCCACACTGATACTTTTGCATG
CGAGCTCTAGGTTGACGCAGATATCCGGGAGATCGCATGGGCCGCTCAGTGAACCGCTGTCGGAATCAATAAAATCGAGTCGCTTAAATCGAGCCAAAAA
CTGCAGAGCCACTAAGCGTAGCTCATGTGCGGGCGAGCGCAGAGTCGCAAGTAGAGAGTTAGCCAGCGAAAGTAGTGCATCCATCGTTAGAACAGCATGC
TGCTTTTCCTCGGACTCCATTCCAATAAGCATCAATAAAGTCGACAGCGTCTTGAATGACGACTCTTTGCCGCGAATTGCTTGCTCCACATATTTCGTTG
TCATCGCCGCACCCTTGTTCTTCGTCTGGTGTTTGGCGATCTGCTGCAGCTGCCACAACTCATCGCGCAGCAACTGGAGTTCGGTAGCTGATGAGCCCGA
CGCAGTTTTCAGTCGTTTGTCAAGCTTTGTGACTAGAGGAGTAGTGAAGCCGATCATTTTGTCGTCATTCAACTGCAAAAGCTCCAACGCCTTGCAAAAT
TTCCAGCGCACAGCGATATCATCGGAGTCGTTTTCGCTGTTAAAGATTTTCTTACCCGCATCAAATAGTGCCTTCTCAGCGTTATCATCGATTTCCTGAA
ACGAAAGCAACCAGTATTGACTTGAGTTCTTCGAGCGTACAATGTAAGCGCTCTGGCCGTCGTTGATTTCGCCTGCATGGACTGTCACGTAGTCACCAAG
TTGACACAACAGCACACTGAAAGCACTGACATCAACTTCCACCAGCGTTTTAAGTGCAAACTCCATAGCGTTCGGTAGCAAAAAATCAATGACAAAACCC
ACGTCGACGTGTCTGTTGTGCAGCTCCTGATCAACAAACTCCAACAGCTTTTGACGCCAGTACACTTGCTCGTCCTTCTTCGCTGCTACTGCAAAAATCG
CCTTCACCTGGGTCGAAATCACATCGTCTTCAGCGGGGAACAGCCGCCACACAGCCTCAAAAGTCTGCATGAGTACGTCCCGCAGGGCATTGCTGCGGGA
CGCGAGAACCTTGTTCTCAGGAGAAACCAGCGCTGCACAAACCTTGTGCAGGCTCGGTACGCGCACCTCGTACGCGTTACTAGCGCCCGAAAGCAGACTA
CCCATTCGCGAAATCAAGAAGCCAAGCAGAACGCTCAGTACGCGGCTCAAATAGAGATCGTCCGCGTCAGTAGGGACATCGTCTTTCTCATGGCGAATAT
TCGCCACCTTGTTCACTACGAGTACCAGGCACTCGAGCATCTCGCCCGAATGGTCGGCATCCGTGTGCTTCATCATTTGCCCACACGTTTGGTATACGAC
CTCAAACACCGCCTCCTGTTGCTCAAGCTGCTCCTGCGACTCCTCTGAATTCTTCGGTCGGAACGCTCCCAGCAAAAACAGCAGCACCTCGCGCATGCGG
GAGTGGAAACCATGGTTCACATTGCGCACGAGCGCGAAGAAGAGCTTGGCCGACCCATCCCTCAAGATATCGTCGTTCCGCCCCGAGCCCTTCACCAGCG
CCGTCAAGTACGCACGCAGGTACTTGCGCATCGCCTTGGGGGACTCGATCCGTCTCAGCAGCACGGCCAGCGTCTGCGCTGCAAAGTTGCGGACAAACTC
CTTGGGGTGGCCGAGCAGCGGGAAGTAGCACTTGTGCACGGCGTCCATGTCGGCTAGCAGTTGAACGCGCAGGTAGCTGAAGAGCATCGTGAGCGTCTTG
AACACTTGTGTGCTGAGCTCCGGGTCTTTTGTGTCGATCACAGCCACCACCAGAGGCAAAACTCCACCAAAGTGCGGGTAAAACTCCTTGCCGAGCTCTC
TGGCCAGCGCCGTCACGAGCTTGAGCACGGGCACGAGCCGCTGACGCTGCACGACCGGGTCCGCATTGTCTTCTCGTGCGTCTTTGAGCTCCTTCTGCAG
GCGCTTGATCACCTTAGAGAGGTGATGCAGCAGTTGAGGAGTGGTGGTCACCAGCGGCTGCAGTGCGCGGAACAGGAACTGGAAGCTGTCGAGCGTCGTG
AGCTCCGCCTGCAGACTCAGTTCCTCCTTGAACGAGAGCACGGAGGCCTCGTCCACGGCGCCCGTGCTCTTGGCATGCAGCGTGAGCTCCGTCTGTAGGT
TGCTCACGCGCTCCTCCACCTTCTGGAAGCGGTGGCGCCGTTTC