Description :
From Genome Similarity Track
Location :
Scaffold_526:5374- 8377
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_526-fgenesh-gene-0.0Imitation switch isoform 1, alias nucleosome remodeling factor 140 kDa subunit
Pytap_DAOMBR444maker-pag1_scaffold_526-snap-gene-0.8Chitin-binding protein
Pytap_DAOMBR444maker-pag1_scaffold_526-snap-gene-0.9Chitin-binding protein

Sequence
3003 bases(100 bases per row)
CGACTCAGACTGGAACCCACAGGTGGATCTTCAGGCCATGGATCGTGCACACCGTATCGGCCAGACCAAGACGGTGCGTGTATTCCGTTTCATCTCGGAA
GGCACCGTGGAGGAGAAGATTGTTGAACGTGCTGAGCGTAAGCTGTACCTTGACGCCGCCATTATtCAGCAAGGCCGACTCGCCCAGCAGAACCGCAAGC
TATCGAAGGACGAACTCATGACCATGGTGCGATTCGGTGCCGACGAAATTTTCAATGCCCGTGGCTCCATGATTACAGACGACGACATCGACGCTATCCT
GGCCAAGGGTGAGGAGAGAACGGAGGAGATGCGCGCGAAGATCGCAGCCGACATGCAGCATAACCTGGCCAACTTCTCTCTGAGCGGAGACGATGCCAAC
GTCTCGAGCcTCTACGAATTCGAAGGCGAGGTTTTCTCCAAGGGCGCAAGCTCGGGCGACGTATTGCCTTCAACATTCATtGCACTCCCACAACGTGAGC
GTAAGGTCAACTACAACGAGGACGACTACTACCGCAAACAAGCAGGTATCGTCAAGCCAAAGAAGGTCAAAAAGCCTGGCTCTGACCAGATCAAGGTGCC
GGTCGTGCATGACTATCAGTTCTTTGACCACGACCGTGTTGTCGCACTGCTGACCACAAAGaCGCAGATTGAGAACAAGCGCAAAGACcTCGTGCGATTG
ATCAAGGAAGCCAAGGcGgAGGAGCAACGTAACAAGTCGCGCGGTAAGAAGAAGGATGATGGTAGTGCCGATGAAGGATCGGCGAACAACTCTGCAGACG
AGGGCGGAGAAGAAGAtAACTCCAAGTCTGCTGCTCTTGAAAAAGAGCTGGAAGAGACTCAGATGGATCCGAAGGAGGCTGCTGAATTGGAAGAATTGGA
GAAAGAAGGCTTCGGCGACTGGACTCGTCGCGATCTGAAACAGTTTATCACGaGCTGTGAGCGTTACGGCCGTGCGGATAAGgTGAACGTGTGTGCGGAG
GTGGCTCAAGTATTGGCGAAGGACATCACTGAGGTCGAGCGATACTtcGAGACATTCTGGAAGCGTTACACGGAGCTGCAAGACCACGCAAAGTACATCG
ACAAGATCGAGCGCGGCGAGAAGCGGTTGGAGCGTAACGAAGTTGTCAAGCAGGCGCTCGCTCGCAAGTGCAGTCGCTACAGCAACCCACTACGGGATAT
GAAGCTCCAGTACCCAAGTGGTTACAAAAGCAAGGGATATACAATGGAGGAGGATGTGTTCCTCGTTGTGATGATGAACAAGTACGGTCCACTCGAGCAC
TGGAGCGAAATTCGTGACGAGATTCGCAAGGCGTGGCAGTTCCGCTTCGACTGGTTCTTCAAGTCGCGTACAATCGGTGAGCTTCAGAAACGGGGAGAAC
TTCTTACTCGTATGATTGAGCGGGAGAACGAAGAGCTCAAGAACAAGCACAGTAAGGAGGAAGACGACTTGGCTAAGAAGGCAAAGAAGAGCAGTTCGTC
TAGTTCGTATTCCAAGTCGAAGTCAAAGAGCAGCAGCTCAAGCGGCAGCAAGAGCAAGTCATCAAGCTCGTCATCGAAGAGCAAGAGCAGTAGCAGCAGT
AGCAAGAAGCGCAGTGCGCCAAGCTCGAGCTCATCGTCCAAGGCGAAGAAGCAGAAGAAGTAGACCTGAAGAGCCCACTATCATgAaCAaTATACTTGCG
TTTAGTATGAACTACGTCAAATTCGGTCGAGCTTGCGAGCGTGGCAAAGCCATTGCGGCTACTGAGAGTCTGATTacGTCTCCAGTAAGAAAAGCAACcG
AcAGCGCAATGCgCGCTGCATTGACTGTGGACAGACTCAAACCcAGaCTGCCAGgTCATAGATTTGTGAGATGTCGTGGCGGTCTTCAGATTGTGAATGA
GCTCATTCCCTGCAAGGTGTAAGGCTCATTACAAAATTTGCcCTCCACCACAGTTTCAAGCAAAGATGAAGCCGTGCGGCCTCATTGTCGCAGTTATCGT
CTCGATGATTTACTCCTGTGACGCCCATGGCAGGATGACGTCCCCTCCAGCGCGGAAGATCACACCACTGTACCTGGATCGGTGCTACGCAGGGCTAAaG
GGGGCAGGAAACGACGACTTACTTCTTGACTCGCTCGAGAGTCTATCCACGAAGAAGCAGGCCGACAGGCCGCACTCTCCGCTGTTCGATGTCGGCAATG
GCTGCCGAGGAACAGTATTTGAGCCGGCCATCCAGCCCATAAGCACATTTGACGCTGATGAAAACGTTAAGGTGGAATGGGAGATTCAGCACAAGGCTTT
TGGATACTTGGAGATTAACGTTGTCAAGAAAAACGACGGCGACTACAAAACTACCTTGATCACGTACTCCAAAGTGAAGACACTCCATCGAATCGACAAC
TTCGGTACGAGTGAAGGTACGGGCTCAGCGGTCGTAAAGATCCCAGGGTCTTTGGACGAGTGCAAGCATGTGGGGATGTGTGCGCTTCAATTCCACTGGC
GCTCCGATTCTAGCAAAGAGACCTTCGACACCTGCGCAGATTTCATCATCAAGGACCCACCAAAGCCAGATGCGACTCCTTCCGTCACTCCAGCACCACC
AACCGCAaCTCCTACGCCGACGCCGAAGGCATCTCCCAGCATGATCAATTTCAACGTCTTGGACAGGAGGTTCATTCCCAGGGTGTAGCCACGTGTAGCA
CTGCTAATtAATAATAAAaGTATTGATATAGTGGCATCTCTTCCTTCAAATGTAGCCATCTGAGGAgTTCACAATGCAGCGACGTGCCACGTTTGACTCA
GGCTGCCACGCATctagAAGGAGGAGATCAAGCGAGCTGAGATGCCAGCACACTACTACATGGCAGTGCCACGTAGGAATCAAGTTTGCCACGTTTAGGA
CCACTtGTCACTTACTGACGAGTCCTCGACATTAAACGACGGTCTGAATCAGGTGCGCGAGCGCGGGgACAGCGCCAAACATGAAGACAACGGCGTGGAG
CTC