Description :
From Genome Similarity Track
Location :
scaffold_83:53733- 55884
Transcript NameFunction/comments
g3070.t1hypothetical protein
g3071.t1 conserved hypothetical protein

Sequence
2151 bases(100 bases per row)
ACCGGATCAGTTGCCCATACAAGACTAGAGCGGAGATTCACGTGACCTACAACGCAGAGCACGCTCGCTACGAAGGGCTACCCGATGAATGGCGAACACT
CAATCTTCAGTTCGGCTTGCCACTTGAACAAGTTCCCAAGCGCGAGGTAAAAGGGTACGAAGCCAAACTGCCTGCTGTACTGGAGATGATGAAGACGTGC
TTTCTAGCGCACAACGGAACTCGTACTGAAGGAGTGTTCCGTTTGGCGCCAGACCAAAAAGAATACAACGAGGTCAAGGCCGCGATCAACGATGGATCCT
TTGAGGACTGCTCCGACGTCCACATCATGGCGTCGCTCATTAAGGTAATACTGCACCATTGTGGGAGACTTGAGTGTGCCTGGTCTCATTTTTACTATGC
AACCAGGTCTGGTTTCGAGAATTGCCCGTAAGCATTTTCAATATGCTACCTGAGCAGCAGATCGCTCTCACGTGCAAACTGGTGGTGCGAAGACAACGTC
GTTACTCAGGAACTTTTACTGATCGTATGTTTCTGTTGTCGTAGGATCCAGACCCCAAGGCCGTTCTGCAGTCGCTAAGGACTTTGCCTTTACTACACCA
AACTGCTGTGTTTTGGCTGCTCGACTTGCTGAATGAAGTCATCATGTACGAACACGAGAACAAGATGACCGCCAAGAGCATGGGTCCGTTTGTCGCTTAT
TTAGTACTTCTGCTTACTACGTATACTTACTCCCTGCTTGTGCCTATCACAGCTATCGTCATAGCGCCCAACCTGCTGACAGTCAATACCTCGGACGCTG
CGGTCGTCGTCACCACCTATCGACAAGTTGCTGACTTTGTGCAGTTATTGCTACGTGCTCGATCGCAGTCAAGATGACAAGATAAATAGCATGTCAAATC
GTTTTTATTGAAATCGTTCCGGAATAATTTAAAACCCTATGCAAAAAAGGAAGGTGCAAGCAAAAAGGAGACTGAAAGTGGACAAAGCTGACTGTCGACA
CATCTATCCAAGTACTGAGCTCTGTGTGTCTACACGAGGCAGCCGTACTCTGGCGAGATATGGCGAAAGATGTCGTCTTCCAGGCCTTCGAGGCCGCTTG
ACGTGATCGCTGTCGGATCTTCCGAACCGGAAGAGCTCACGGCAACGGGCTGGTGAGTCACGGCAGTAGCTTTCCTCATGGCCATAGTGGGCGATGGCTG
CAGGGGGAAAAAGTCGTACGAGACGGCGTCGAGGGAGTAGCCGCACGACGGGTGGTCGTTCTCGCCGTAAGGGTCCATTGAGGTAGTGCTGAGCTCGCCA
AAGGGGTCGTACATAGCGTCGAAGACGAAGGCTGGCTGCACCGTGGGCATCAAACCGGCCTGGCTGTATTGGTTGTACTGCGCTCGGCTGTATTCTGCGG
CCGCGTTCATGGTCATGGCATTGCCGAAGAAGAGGTTCTCGCGGTGCGGTGAAGAGGCCGAAGCCGAGGACGGCGAGTCTGTGAACAGGTGCTTGCGCGC
CTTGTTCCTGTGTACGAAGTGCTCGACGCCCGGTCTGGGGCTCTGCGACCCGCACGAGTCCTCGTCCGAGTCGTGATCATCGCCCCCGTCGACGTCGCCC
TGGAAGAAGTGGGCAGGCAGAATCTGGCCGAAGGGGTCGATGCCGTAGGTCTCGGGCGATAGGAGGCGTTTGAGCTGACTCTGGTAGCCTGCGAATTGGC
GCAGCTGCTTGTCCGAGAGCGGCGGGCCCGTGCCGTCCTGTGCCTGTTGCTGGCACTGCTCCAGCTCCTGCAGCGAGCGCTTGAGGCTGCGCACCTTGCG
GTACGGCCAGTGGCGGATGCCGATGGCACGGCAGCGTTTCTTGAAGGCTGTGGCGCGTACGCCGAACTTCTCGGCCGCCACTTTGAGCGGCAGGTGGAAG
TGACGACTGAGCGCCGCAAAGTTGCAGGTAGCGACGGGTAGCGGCGACGCTGAGCCGTCGGAATCCACGGGCGAATCACAGGCCGCGCGCTTCTTGAAGT
TGTGAGCGGCCACCTGCATCCGTAGCGACTGCTGGGCCTTGTCGGCCGTGGGCGACTGGAAGTTGAGGTTCATGACCCTCGAGTCGGCGGGGGTGGGCGT
GGCCGGCAGCTCCATCTCCATCTTGACGAGGCGAGCGGAAGGGTGCGGAGC