Description :
From Genome Similarity Track
Location :
Scaffold_1:5372182- 5377244
Transcript NameFunction/comments
Physo_473042conserved unknown protein
Physo_477189cyclopropane-fatty-acyl-phospholipid synthase
Physo_473312Hypothetical protein

Sequence
5062 bases(100 bases per row)
ATCCGCATGAAGTTTTCAGACGTTAATCAGTGTACAGCCACTCGTTCCTCTGCTTCTGCTTCTTGGCCTTCTTCTCCGCCGTTATTTTCTTCCAGTCAAT
GTGTTTTCGCTTGAGTTGCTCCTTCCTACGTCTTGCCTCTTCTCGGTTCTTCTCCAGCTCCGTCATGTCAAAGAAGTGGCTCATTTGCCGCCCTGCGCGA
TCCGGTGCTATTCCGGCATTCTGCCAGTATTCATCACCACCAAGTTGCTCGTACTTGCCTGTCAGCCGGTTAAACTTCGCACGCGCAACGTAGTTCACGC
CCGAGACGGTCTTCCGCCCCGCAGCAGTCGAATCTGACTCCGATTCCTCGGGCGGGATCCAAATCGCCAACTAGACAAAAAATATGTCCACAATATGGTT
AGTAGTGAGTGCGCCATTCGCTACTGTAAAGCACAAAACAATGCTTGAACCATCAAAAACTCCAGACAACTTACCCCTGAAACAATAGGCGCATCTGGCT
TATTCCACTGCGTGACACCAGTTACTTCGTTATGGTAGTAATACCGCTGCGTCTGCGCGTCGACATGTTGCTGCCATTCCGCTTTTGCGGTTCGTGGAGC
ATCAGCACCGTCTCCATCAACATGAGCCGCGGCAGCAGCAGGAGGAGCGCTACTGTCAATCCCGCTTAAAATGGCATTCAGCTTGCTGAGATTGCCCGAC
GGGTCCAGCACTTGCTGCGTCACTCGTGTGAGGCGTTCCGTGCGCATCCGGTTCAGATGGGCCTGATACTCGGCAGAAACCTGGGGAGCAGCGAGCTGCG
CTGCTGCTGCTGATTCATCGAAGTGCTCAGGCTCTTCCCACTGCGTTTGCCCTGTGCTGGCATTGTAGTAGTACGGCTTGTTGCTGGCAGCGTCCACGTA
CTTCACCCACTGAGTAGCCGCCGCAGTAGTAGACTTGTCATCATTAGCCGCAGTAGTAGACTTGTCATCATTAGCCTCTTTTCCCTCCTTCTTCCCGTTC
TCAGTCTTGTTATTGGCCTGCGTTTCGTCCTCCTGGCTTGTATCCTCTCCTGCCTCCCCCGTCTCCTCTTCCTGCTGCGGTGTGTCCTCACCATCGTCAG
TCTTCTCGCTCTTTTCGGTCTCGTGGTCTTCTTCTTCGTCTACTTCTTCTGGAATAAAACCATCCGGTTTGTCCCATCGACTGGTGCCGCTCACTTCGTC
GTAGTAGTAGGTGGTGCCAGACTCGTCGTCCACGAATGCACGCCACTTGGGGGGCTTGTCTTCGCTCAGATCTTGCGCCCGCGGAGACGTGAAGCCCGCA
GGGACCTCCCACGACGACTCGCCCGTGCGCATGTTGTAGTAGTACGCTGTGCCCGAGGCCTCGTCCACGTGTTTCTCCCACTCGCGCTCGTCGCCGTCGC
CATCCGTGCCGGTGGTCATCGAGTTGTTTTTGCTTACGACTGCGAAACAAGTTCTAATTTTATTTGATTCAAATTGAACCGAATCAGATTTAAATAATTA
GAATCTGATTCGGTTCAATTTTGAATCAATATATTAAAATTTAGGTCTAGCGTTTAGAACATATAAATTTTCAATTATATGGAGTTTAGCCCATACTGAT
CTGGAACACTTGAAGTGCTCCGGATCGGTAGCAGGCGGCGGAGTGCAGCAGATAGAACTCCCAGGTGCGCTTGAAGGATTCTGGGAGCAACGGCATGCGT
TGCAGCTGACCCATGTGATCTGTCGACGCAACTTGGCCAGCTCCGCGAGGTGGCGTGTCTTGGCCCCATTGAGCTTGGAATCGCCGGTTCCACTCAAGGA
ATGTGCGCTCGTAGTGGTCCGAGTAGCCGACTGTGTCTTGAAGCGTGAAGCCCGTCTCTCCGGCTAGTCGGCGCATGAGCGGCAGCGTGAGAGCGTAGCA
AGGATAGGCGCTGTGCACGTACTTGTTGGTCCATGCATGGGTCGTCATGTGCGCGGCCGTGCAGGCGCTGAACTCCAGCAGGGTCGTGCCGTTTGCCGTT
TGGATGCGCTTCAGCGTGCGGAGGAATCGCGTACGTTGAACGTCTGGCACAGTCTCCACCACACCACACAATGTGATACGGTCGAACTTGGAGGCGCGGA
AACCACTCAGAATTGTAAGCAGCTTCTCGGGGGACTCTGCTACCACGAGCTCCATTTGGTCGAAGACGTCGAGCTCGCGAGCGAACTTCTTGGCTCGGGC
AAACTCCTGGACAGAAGATAGAACGCATACAATGGTCGCATCGGGGTGCTGTTGGGCAAGGTAGCAACCCACTCCTCCCCACGAGCCGATACTGATGTCC
AAGACAGTGTGACCAGCCTACCGTACAATAAACAGAAAGGTTAGCGCAAGTAGCTCACACGAGTCATGCGCGCTGTACGTGAGACTCTAAACCCACCCGA
ATGTCCAGCAGTTGGTCCAAATTTGCAAGCTTGTTGGTCTGCGCAACGTCAATGGATGCTGTGCCGGCAGTCCAAATGCCAAAGCCTTGGTGGAAGTAGC
GGTCCATGTATCCGTGTCGAAACTCGGGGCACAAGTCAAACTGCTCCGAGACAGCGCCAACCACGAGGCCCATAGACGACGGCGGGTAATTGAACAAACG
CGCAGCCAATGCCACGAAACGTGCGCTCCAAGACCGGTACATCTCCTGTCTACCTTCCATCGGAATCGTAAGCAGGCTGGCGACCACCTCGTCCAATGTC
CGTGCGGAGTTTGTCGCCCACAAACAACCCACGTATGACTCGCCAATAGCCACAAGCCCTTCACTCATCCAGTCGAGCCAAAACGAGTCATCTCGAACGA
TGAAGTCCTGAACGCAGCGACATGATGTTAGATGTCGTGTTAATCGCGGGGAGATTCCTCCGCCAGACGTGTAAGGCAGGCATGCTCCTACCAGATTTGG
GCGAATGCCGCCGCTGGACAGCAGACGACACATGATTGTCTTCGCATTTCGACGCAGTTTCGGCAAAGAAAGCGATCGAATCAACTGGAGGCAAAACAGA
ACAGATCCAGCGATTGCCGTCGCGACATACACCCAGAAAGACCTCTGTCACGCATGCACCAACAGCAACACCAAAAGAGATATCCGGCAATGCAATTAGA
AAAACTTAGACACGTCTATCAGCATCCGATAGCCGGATAAATCGCCTTTCACATTACTACCTGGTGTGCCAAGACGCAAAAGAGCGGAACGAGCAGGTTC
AGCATGAGCTCCATCTTGTATGCGGCATTCCAGAAGTGCTGCGAGCGCGGCGGAGAGAAGCGATAGATGTGGTCAGCCTTGGGGAAGACGCCTCCACCCA
CCACAAAGTGGCTCCACAGTCGTGACGATCTGCTCGAGCATCAACACAATAAAACATATCAGCGTCAGATTCAGGGCCCTTCAACTCAACAAGCATCTCC
ACTCCGTCCTACATTAAAGCTGGAACACTCATCCAGACACGGACAAGCGGCAGGTAGCACGAGACCAGCAGCATTGGCACCAGCAGATGGAGCAAGATGT
CCCCCACCCGAGCTGCGATGCCGAGCAGAGGCGAGCTAGCCCAGACCCCGAGCCAGCCGTTCAGGATGGCTGTGAAGGCGTAGCGGTCGAAGACGCGCAG
GGAGTACCAGCCCACCATGATGGTGATGCCCATGGAAGTGGCGATACCCAGCGCAGCCTCCGACGCCAGCAGGTGCGCAATCACGGTGAAGGCGAACCAG
CAATTGGTGTACATGGTGCGGATGCCCACGAGTGGGGGCAGCACGACCACGCTGAACAGCAGCGCCACCGCCACTGCTGCGTCTACATGGTCGTCAGTCT
GCACGGCGTCGTGGCTGGCGCGGCCTAGAGCACCCCAGCCCAGCATCGTGTCCATCTTGTGAGCACTTGGTCGAAAGTCGCGGAGTGAGCTGCTCGCCAC
AGCCTCAGATTTCTGACGTCGGAAAGTCGATGTCGTAAGATTTACTTGAGAGTAGTATGCGGATTAGGATAAAAGCTAGTACGTTCTCAGAGCAGCAGGA
TTGACCAAGGATTGCACCAGTGTGCGCCGAGGATGGCACCAGCGTGTCGAGTTGGCTGTGTCTACAGTAGAGGGTAGTGGAGACTTTTGTGTTGCTTTGG
GATAGTAAACATGCACGATCTATTGGTGACCATATTACAAGCTCGGCTCTAGGAAACACTGGACCACGAACTCGTGAACGCCTGCTCGGTTCGCGAGTAC
ACACAGCATTGGGATAGTAAAGTTGTAGGCCAGCTCGATCTTGCGAACTGCCAACCAAAACGCCTTGGGGCGCGGCGGGTAGATGTGGTAGATGCCGTTG
CCCGTTAGACTGAGGTCTCCACCGGCGACCAACTTGATCCACAATTGGGAGAAACTGCATGCATACACACACGCCACGTACACAGTGAGTATAATAGCTT
GGCTCACACAACACAGACATATCAATTTCCGACAAGCGGCACTTACATCAGGATGGGTGCTGTCATCCAGAAGCGCACGAGCGGCAGGTAGCAGAACGCG
AGCATGAGCGGCACGCCCATGTGCAGCAGGAGATCGACGGAGTTGGCTAGCAGCTGGAAGGGGCGATATTTGCTCAAGAAGCCGAACCAGCCTTGCAGGA
TGCCCATGAACGTGGTCCGGTCAAGCGCGCGCAGCGAGTACCAGCCCATCATGATGGTGAGCCCCAGCGACGTAGCCATGCCCAGCGCCGCCTCCGACTC
GGTCACGTGCGCCAGCACCGTAAAGCCCACCCAGCAGAAAGTGTAGAGGATACGCACGCGCAACAGCACAGGCAACAGCGTAATGGCGAACAGCAGCGCA
ACGGCCTGGACGGCGTCCGAGCCCAGCGGCGTCGACCCAGTGGCGCGCTGCTCTCCATCGCGGACCCGCAGCACCGTACGCGTCAGCGTGTCATGCGCCA
CTGTGAAAAGATCAGAAGCATCCATTTCCGCGCCGCGCAGGACGAGTGGCGGCGAGCGTGACGCGCCGCTGGATCAGATCGAAGAATAAAGCAGCGGTTG
TTCCTCTCTGGAGTGGTGAGACTCGAAGTGGTACAACCGATATTCCGACTTGATGACGCGAG