Description :
From Genome Similarity Track
Location :
contig_15:537200- 546233
Transcript NameFunction/comments
g4277.t1RAW36312.1 hypothetical protein PC110_g7435 [Phytophthora cactorum

Sequence
9033 bases(100 bases per row)
CTTCACTCGGCACCGGGACGAAGCACCTTCGTAGGACGAGCTGCTGCCGACGCGGAGCCCTTGAGCACGGTGTGTTTGCGCTTGCGCAACTGCTTGGTAC
GACGCTTTTGCTCGTTCTTCTGCATCCGGCGCTGGGCTGCCCGCTGCGGGTCGGCCACTGCTTCGGTGCGGCGCTGAAGTTTCCGTGCGGCGCGACGCGA
CGCCATCTTCCTCTGCACGAACGAGTAGGCCTCCAAGAACGTCGCCGCTCCCAGCTTTTTCTCCAGAAGCTGCAGCACTTCCTGCGCAAGTAGTGCGCTC
TCAGGTGGTGCCACGGACTCCGGTGCAGGACCGCTCCTTCGGTTCTTGTAGCGGTTGCGCTGTTGTTGCTGCAACCGCACCTGCTCCTGCTGAGCCTGCA
GCTCTTCCAGCTTGCTTGAAGCTCGATACAGCGGATTGATGATCTGAACAACATACTGCTCGGCGAAGGCCGCGTCGTGGCTGTGCAGCAGAGCGGCGAA
CAGCTTGAACACCACGGCTTGCACCTCGTTGCTGCAGCTTGAGCCGCGTGCAACGTACGAGAGCCGCGTAAGCAGCCAGCCCATGGGTGTACTTGCCTTT
GCGCGCTCCTCGGTCTTCTCCTGCTCCTCACGACGCTGCAGTTCCGCCTCGTCCTCGTCAGCCTTCTTCTCATCAGTGGCAGTGTCCTCCTCATCCCCAC
CCGCATCCTCAGCTTCAACTTCAACGCTTGTGGCATTCGCCTCGCCATCCTTCACGGAGTCAGCAGCGGCAGCCGTCACGTCCTGCGGGATATCGGTTGT
CTCAAGCGCTTGGCACAGGAACGGCAGCGCTGTAAGAACCTCGCTAGTTAGCTCGCTGTTCAGTGCCGGTGCCTCCAGCAGCTTGCAGAAAGCACTAGCC
CAGATGAACAGACGGCCAGGACGCTGCAGATACAGCGCTCCATTCTGCAGACGCTCCAGGGCATCTCCAGATAAACGCTTCACCGGAGCTGCAAAGGCAA
GCGTGCTCGCTTGGCGGCGGCTCAGATACGACGTCAACAATCGGGTTGCGCCAAGACGCACCCAGGCGTGGGGGTACTGAAGCAACGGCAGCACCACCGC
GTCCAGGAAATTCGTCGACACCTTCAACTCCTCCAGCCAAAGCTCGTAGGGACCAGCAAGATGGTCGCTGAAGGCTCTAAGCGCGACACAAACATGGTAT
GTCGGCTGCCACCGCACCTGATCACTGTCCTCCACAGTCTGAAGCTCATGTAGACTGCGCTCGAGCGCTGTGCGCGTCGCAGCCAATACCTGAGGCGCGC
TGCGCTCCATGAATTCGGGTCGGGTTTCCAGCACAAGCGTCGTCACCTGAGCTGCAGCCCCGAGTAGCTTCACCGCATCCGCAGTATTCGAGTTTGCTGC
TTGTGTCCACCACGTGCACACCAGCAGAATGCTCTCGTTCAGCTCCTTGTTGCCAAGACGACGCACAAGCGTGCTCAAAGCTGCCCGAGCCAGGTCACGG
CACTCCGAAGCCTCGTCGTTTGCTAACCGTAACACCAGCGGCAAGAAGAAGAACTGGGACCGAGCGTTCACCAAATCCTGCGGGAGCTTCGTGAGAAGCG
AACGAAGAGCCTCAAGTACGGCAGCGCGTCCAGTAGCGTGTCCGTAGCTCAGGTTGTCCACCAAGAATTTGAGGTGACGAGACAACCGCTTGTTTCCAAG
AGGGTACTCGAGCAGGAATGTCTGGTAGATGGTTGCACAGTTTAGGCGCGCACCCGGGGCATCGCTCTGAACAAGTAGCTCGCCAACACGCAGCATCACG
TCGTACACCTCGCTCACCACCAGATGAGAGTTCACAATGGCCTTCAGAAGGGCGAATGTGGCGTTCTGGTGATCTTGCTCGTCAAGATCGGCTCGCAAGA
AACTCAGAAGCACGCGAAGTTGCGGTTCCGTCAGACGCAACGCCTCGTTCTTCGAGTCCTTGGGCGCGTTGCCGTTCTCCTGTGCGAGTTCCAATCCTTG
CTGTTGTCTAAGGAGCGCAGTAAGGGTGCGGTAGCATGTCTGCACCATCTCGTTGCGAGTAGCAGCTCCAGCCTGCTGCAGAATCTTAAAGAGGCGGTCA
AGAAGAGGTGTGCGCGCCACCCGCAAAGCAGGGAGCTCTTCCTGTCGAGGGAGCATTGAGCCAACGCACTTGAGCGCGTTGATAACAGCTCGGTCGTTCT
TTGACTCGCCAGCGCAACGCATCAGCAGAGGCACAAGCGGGTCGACGAGCTGGGCCGGAGCGTCTGAAATCTTCTCTGCGTCTTGGTTCTTGGAGCTGCC
ACTCTTGCGGAGGAAGGTGAATACCAAGAAGACACCAAAGTTTAGAAGCTCTCTCAGATGAGCGGTGCTCTCGGCTAGCAGAGCAGCAATCGCCTCGCGC
TTTTGCTTTTTGGTCTTGCTTTGCTGTTGCTGGCGCAGTTTATCAAACCCAGTGACCTGTTGCTGCATCGCAACACGTACAGTGTCCCGGGCTTTCACTC
GTGCGGCAAGCAGTTTAGTGGCTCGCGCACTCTTCTCGGACACAAGCCACGAAGTCACCAGTGCCGTGCTGCTACCTGCCGCTTCGTATTGCTCCTTTTC
CCTCTCTGAAGTCGGGCGCAAACTCTCCAGGCTCGAGTTGAGCACATTGTACGCGTAGAGGAACATGTAGGACGATTCCACAGAGGGGTTCTTCGCAAGG
CCAATCGCTATGCGCTTCAATGCTTCCTGCAACGCGGCCGTAGCTTGAGCCCCAGCGTCTGTCGCCTGGAAGCGCTTCACAAGAGCACTTACGACCTCGT
GGATGCTTGGATTGGGCAAGAACGGCAATGATCTTGCCAGCAACTCCAGCGAGTCCAGGCTTCGCCCACCGCTCGAGCGGGCCTCCTTCATCTTGGATTT
TTGAGCCGATCTCCGTTCCACGCCTCCAGCAGCAGCCTCCGCGGCCTCGCCGATGGTAGTCATACCCTGGAATAACTCTGCGGCGAGAATCTCCATCAGG
CTTGGCACGCAAGCATCCAGAGGGGATGCAAATTCAGCCTCGCTCTCGGCTTCCTGCTGCTTGTCTTGCATAAGCAGCAATGATTGAGGCTTCCGAGGTG
GGCCGGCGTGTCCTTCACTCTGCATGATCTCGGGGAGCTTTTCCAACAGGGCGTGCACCGTAAAAGACAGCACATGGACCATGTATCCATCGCGCAGAGT
GTGGCGAAGCTCCTCCACAATCGGTAGTAGGAAGCGTGCACCAAGCTCCACAGCGATTCTAACCAGCGTGGTACGAGCTGAAACACGCACAGCTTCATCC
TTATTTTTCAGCAAGTTCGCGAAACGCAACAGCAGCTTGGGTAGCTCACGTTGGAAGGTCTCAGCCCGCAATCGCCGCAGCACCTTCACGACAGCCAGCG
CGAGAGGCACACGGACAGAAACAGACTCCTCGGAGAGCGAAGATGGCTCGCTATCGTTCTCTGCTTCTTCGAGCTCTTTTTCGAGCCCGCACTCTTGAAC
AGATACGAGTAGAGCATCGGAAGAACTTGTGTCTCCATGTTATCCTGCACCTTGGAGGATCCGTCTTCATCTTTCTGCTCAGGCTCGGAGGGGTTGCTGT
CAGTGTTCACCTTACTGGACGACAATTGCCACTGAGTAGCCGCACCCGGCGCCTCGAAGTGAAAGTGGTCAATCACTGCGCAAATGGACATAATGATAGC
GCCTTCCATTTCAACATGACCGTCGATCGACTTCAGCAGTCTGCGAAGCAGTGACAGGTAGTGCGACCAGCTCAACAGGCCAGCAGCACTGCCTACGCAC
GCTGCAGCTTCAGCGCGCAGAGATTCCTGGCTCTTTGCGTGTGTCTCGTAGACAAAGTGCAGCACCAGAGGGAGGATGACACCATTCACCGTCGAGTTCG
AAAAGCACACAGGTTCTCCAATTTCCTCACCATCAACTTGACCCTGGGCCTTACCAGCCATGGAGTCCATGAGAGCGCTGAGACGCTGAAGGGCACGACG
TCTGCGGTGAGCTTGAATGTGCGTAATGTTGTAGAAAAAGTCAGCCTCTGGGTCCTCGTGGTTGCGCGCCAGCACCAGATCTGCTGGAATAAATGCAAAC
TGTCTAAATGCCTTGTGTTGGTCCGCCAACGATCCCAACAGAGTCACAAAGCCTCGCCGCGCATTCTCATCAGTCGAGCGCAGACTTGCCCGCACGCAAG
GCATCACCAGCGACTCCAATCCATTAAGCACAGGAGACTTCGCGGCATCGTCTTGCCTGCTCTGCTCGACTGCAATCTCTGCTGCTAGTCCCAGGAACAC
CGTAAGGCTGGCAAGCGCAGCGCTGCGCACTGAGAATTCAGCGTTGTGCATGGACTGCAGGCACTGCGCCACCAGAGGAGCTAGCAAATGAGTCTCGTGC
GTAAACCCGTCAAATCGTGTGGTGTTGAGGCGGTTTAGCGCAATCAGGCGACGCTCGTAGTCGGTCTCCTCGATTTGCTTAGCGTCGTATGCGTTGAGCT
CATCCAGCAACTCTGCCACGGGCGCCAGCTCTGTAAGCGCAGGATGCGCGCCCAGAGCTGTAAATACCATTACTAGTTTCAGGCGGGTATCACGATCGGC
AATGCAATTCGGACCTGGAGCCAGCAGCCGTGCAAGGGCGAGCACATGCTTCTTAGGCTCCGAGAGCTTCGGCACCAAGTGGGCCAGCACCTCCAATAGG
TTTTCCTTGTCCTTAGGCGACGTCTGGTGGTTGCGCAGCAAGAATGGCAATAGCAGCTGAAACAGATCGTGGGCAGCAATTGCCACGTCTCCGTCAGAGG
CGTCTAGATGGTGCGACAGCCGGCAGAGGAACGTAAGCTCCTTTCGAGATGATCCAGCGTACCGGTCGCTTGCGTAGCGTGCAGCCTTGGCCTGGAACCG
CTGCACAAATTGCTCCAACACGAAAGGGATGTGGCTCACAGCAGCACCTTGTCATCCTCCTTGATGGCAGTCATAGCTCGTCTTCGGCCAACACACTTTC
ATCTCCATCCAGCAATGAATCCATAAACTGCAGGATAGAGTCTAGAATTTCAGGCGAAATGCCACGACTAGATGCGGACGACACGCTCGATGACGTCAAT
CCTGCCGACAAGCATGAGATAACGCTTAGCACCAGAGGCTCCGGGATCCACTGACGTGCCCTGTCGGCGCGACCCATTGCGACGAGGAATTCCAAGAGTG
CGGAAGCCTTGCCAGCACCGACAACCGCGTTGGACAAGTGCACAACGGCATCATGCGAAGTTTCCAGCACCGCTTCTACCCAGGGTTGGAGGCGCACGAG
CGTATCAAACTTCATTAGCAAAACATAACAATGGTTAGTACTTTAATTGAACAGTGGATTTGAGAAACCAAGCGCCGTACCGTGTCGATCAACTCTGCGA
GTCGGCGGTATGTCAGCATGCGGATCTGCTTCTTCATCGAAGCAGATGTCACTAGGCTGTCAACAGTCGACGAGGGCTCACCAGCTTTCCGCTTCGTGCC
CACAGCAGCCCCTGCGTCCTCCTTGTCATCATTATTTTCGCCAGTAGTAGCAATTTCATCGTCATCTTCGCCGGAAGCTATACTGATCTGAAGAATAGCC
AGCAACACGTCTGCAAGGCGAGGCGCAAAAGCGGCCAGCTTCACGCCAAGTTGGTTGATAAGGTCCTCGAGCAAATTCAAGAAACCAAGAATGCGCGAAG
GCTGTACATTGGAGACTGCTACGACAGGTTTCACGTTGTCAGAGATAATAACAGTGTCTTGAGCAAGACTCTCGGGGCTTCAATCGATACATCAAACGCA
CGGACCACAAGTTCCACGAAGCTCGCTAGCTCGGGCGCCTCCAGCGCTGCCAAATATGCTAAGATGGCTACACGGCGCGCAGCCACCGTGTCACCATTGT
TACGGCCCTTCTTGCTCACGCATTTCGAGTACAAAACGCGCAGCAGAACAGGGAGCAACTCAGGTCGGTGCTCGCGAAGCACAACCCCCTCTCCGTCGCC
CACCTTAAAGCTCGCCAGTTCTTCGCGGAACGACGAAGAATCCGTCAGCCGATTCAACTGCGTCTTGTAGGACACAACTGCCTTGTTGCCAAACGCGTAG
ATGCACTGCAAAGCAAGCTTCGAAACCACTTCGTCCGACTTCATCAACAGGTCGAAGAAAAGAGCATGCAGCAACTGCTGCCCGTATGCACCTTTCATAT
TGTGAAAGACAGCAAACAGCTTCAGCTGATCAACAAACTTGCAACGCACTTCCTTGGTGGTCAAACCTTGGAACTCAACTGGCTTACGCCAGTTTGGAGA
TGCAGCATCATTCGAACTGTTGGTTGTTTCTTCGAGCTTGACAAGCACCTGGTCAATTTCCTCGAGACGGTTGGCGTCCAGCTCATCCGTGTAGATGGCG
CTATACTGGTCGCGCAAAAATGTAAGGAAAAGCGGTACCATAAACTTGGTTTTGGCCTCCACAAGGTCCGCGAACTTCATAAGTCCCTTCCACATCAGCG
AATGATGAGTAGGAGCATCTGTGACACTAGATACATGCACCTTGCCCTGCTCCAGCATGCACACGCGCTCAAACTCCTGAGCAACGCCACTTTCGTTACC
AGACGTGCTCGATTCACTACCATTCGGGTCCTCGTGGCAAAGTGAAGCGGCAAGAAGCTCTGCACTGATGCATGGCCAAAATTCGTTGAAATGCAGCCGT
GCTGCCGTCTCCACTGCATCCGCGATGTGTGGCCAAATCATAGAGAACTTGACGTGGTACAGACCCAACAATTGGTTCAAGGCAATTTTCTTGTACAGCT
CCGGGGTCTGTGGCGAACGACACAGGATCTTCACTCGGGTCAGCAGGCGCACCACTTCTCGCTCAGTAGCCACACTGATACTTTTGCATGCGAGCTCTAG
GCTGACGCAGATATCCGGGAGATCGCATGGGCCGCTCAGTGAACCGCTGTCGGAATCAATAAAATCGAGTCGCTTAAATCGAGCCAAAAACTGCAGAGCC
ACTAAGCGTAGCTCATGTGCGGGCGAGCGCAGAGTCGCAAGTAGAGAGTTAGCCAGCGAAAGTAGTGCATCCATCGTTAGAACAGCATGCTGCTTTTCCT
CGGACTCCATTCCAATAAGCATCAATAAAGTCGACAGCGTCTTGAATGACGACTCTTTGCCGCGAATTGCTTGCTCCACATATTTCGTTGTCATCGCCGC
ACCCTTGTTCTTCGTCTGGTGTTTGGCGATCTGCTGCAGCTGCCACAACTCATCGCGCAGCAACTGGAGTTCGGTAGCTGATGAGCCCGACGCAGTTTTC
AGTCGTTTGTCAAGCTTTGTGACTAGAGGAGTAGTGAAGCCGATCATTTTGTCGTCATTCAACTGCAAAAGCTCCAACGCCTTGCAAAATTTCCAGCGCA
CAGCGATATCATCGGAGTCGTTTTCGCTGTTAAAGATTTTCTTACCCGCATCAAATAGTGCCTTCTCAGCGTTATCATCGATTTCCTGAAACGAAAGCAA
CCAGTATTGACTTGAGTTCTTCGAGCGTACAATGTAAGCGCTCTGGCCGTCGTTGATTTCGCCTGCATGGACTGTCACGTAGTCACCAAGTTGACACAAC
AGCACACTGAAAGCACTGACATCAACTTCCACCAGCGTTTTAAGTGCAAACTCCATAGCGTTCGGTAGCAAAAAATCAATGACAAAACCCACGTCGACGT
GTCTGTTGTGCAGCTCCTGATCAACAAACTCCAACAGCTTTTGACGCCAGTACACTTGCTCGTCCTTCTTCGCTGCTACTGCAAAAATCGCCTTCACCTG
GGTCGAAATCACATCGTCTTCAGCGGGGAACAGCCGCCACACAGCCTCAAAAGTCTGCATGAGTACGTCCCGCAGGGCATTGCTGCGGGACGCGAGAACC
TTGTTCTCAGGAGAAACCAGCGCTGCACAAACCTTGTGCAGGCTCGGTACGCGCACCTCGTACGCGTTACTAGCGCCCGAAAGCAGACTACCCATTCGCG
AAATCAAGAAGCCAAGCAGAACGCTCAGTACGCGGCTCAAATAGAGATCGTCCGCGTCAGTAGGGACATCGTCTTTCTCATGGCGAATATTCGCCACCTT
GTTCACTACGAGTACCAGGCACTCGAGCATCTCGCCCGAATGGTCGGCATCCGTGTGCTTCATCATTTGCCCACACGTTTGGTATACGACCTCAAACATC
GCCTCCTGTTGCTCAAGCTGCTCCTGCGACTCCTCTGAATTCTTCGGTCGGAACGCTCCCAGCAAAAACAGCAGCACCTCGCGCATGCGGGAGTGGAAAC
CATGGTTCACATTGCGCACGAGCGCGAAGAAGAGCTTGGCCGACCCATCCCTCAAGATATCGTCGTTCCGCCCCGAGCCCTTCACCAGCGCCGTCAAGTA
CGCACGCAGGTACTTGCGCATCGCCTTGGGGGACTCGATCCGTCTCAGCAGCACGGCCAGCGTCTGCGCTGCAAAGTTGCGGACAAACTCCTTGGGGTGG
CCGAGCAGCGGGAAGTAGCACTTGTGCACGGCGTCCATGTCGGCTAGCAGTTGCACGCGCAGGTAGCTGAAGAGCATCGTGAGCGTCTTGAACACTTGTG
TGCTGAGCTCCGGGTCTTTTGTGTCGATCACAGCCACCACCAGAGGCAAAACTCCACCAAAGTGCGGGTAAAACTCCTTGCCGAGCTCTCTGGCCAGCGC
CGTCACGAGCTTGAGCACGGGCACGAGCCGCTGACGCTGCACGACCGGGTCCGCATTGTCTTCTCGTGCGTCTTTGAGCTCCTTCTGCAGGCGCTTGATC
ACCTTGAGAGGTGATGCAGCAGTTGAGGAGTGGTGGTCACCAGCGGCTGCAGTGCGCGGAACAGGAACTGGAAGCTGTCGAGCGTCGTGAGCTCCGCCTG
CAGACTCAGTTCCTCCTTGAACGAGAGCACGGAGGCCTCGTCCACGGCGCCCGTGCTCTTGGCATGCAGCGTGAGCTCCGTCTGTAGGTTGCTCACGCGC
TCCTCCACCTTCTGGAAGCGGTGGCGCCGTTTC