Description :
From Genome Similarity Track
Location :
Scaffold_210:5372- 9476
Sequence
4104 bases(100 bases per row)
CCCAAGTAGGCTCATCGTAGCCGACCCACTTAACTTTAAACTTCCGTTGTGATCGTGACGTACTCGTGGATAATGGTAGCTCATCGTCGAGAATTGCTTC
GACTTCATACTGGTTTGTACTTGTGTCTGGTTCCCAGCTGTCTTCAGGCAGTAATTCTTCGTCAAAGTCAAATCGCTGAGTCTCTTCGAGGTCGGCGATT
AGCCTCGTCTTTGGCCTTCCGCCGAGTTCGGAGACTGCCTTCAGACGTGATACATGGACCACTGGGTAGAACCTATATCCACTCTTGTCGGGTAACTCCA
ATTCATAGGCGAATTCTTCCACCTTCTTCTTCACCCTGAATGGTCCATGCCATCGGTGGGCTAACTTCTTGGTCAGGCCCGACTTGACTCGCTCCATAAA
CAACCAGACTTGATCTCCTTCTTTGAACAAGGATTTGGTGGATTCATCGCCTGGTTCTGCAACTTCATCTTCGTCATCTGCTGTGTTGGGAATGGATCTT
TTCTACTTCTTGCTCAACGCTTCGTTGTGCTCTCGAGCTCGTCGTGCTTTCTCTCGCACTTGGAACTCAGCTGCTAATCGAAGTGCCACTTTTCGTTGTC
TGTTCGCTTCTCGGCGCCACTCGACTGCGTCCGCCGAGTTGACTGGGCGTCCCTGTCCACGTCGTATTGAACTCGTCATAGCCTTGAGTGTAGACTTGGC
GTCCCAACCATGTACCAGATAGAAAGGGGTTTCACGCCGAGTCAAATCTCTTGAGTTGTTGATAGCGTGTACCATCTTCTCGGAGATGTCATCCCAGTCG
GCTTGAAGTGGGTCTTCCACGTAGACCCGTATAGTCTGAACCATTGTCTTGACTGACCTCTCTTGTTGACCGTTGGCTTGTGGTCGGTAACTCAGCGTAG
CTCTTGATCTCGACTGCATCATCTCGGAGAACTTTTGATATACTTCACTCATAAACCTTGGATCTCGGTCGTGCCGTATCAGAGACGGAGCCCCGAACTG
CCTGAAGACGCATTCCTCAAATACCTTGGCCACTTCGAGTGCTCCGGTGTCATTCATAGCCTTAGCGATAACGAATCCCGTGAAGTGGTCCTGGAACAGC
AGAAGTGCAGTATTGCCCCGCTGAGTTCGAGGAAGGGGAATCACGAAATCCATTGACACGACTTGGAATGGATGGTCTGACACCACATTTCCCGGCGAGT
AACCTCTCAACTTTGGCTTGCTCTTACTGGTATTGCAGTCTTCGCAGGCTCTAACATGTTTCACCACGTCGGCGTACAGACCAATCCAGTAGTAGTCGGC
TTTGACTCGGTGATACGTTCTGACAATGCCTTGATGCCCTCCTTCGATCGAGTTGTGACAGTTATGAGGTATTTCGTCGACCATGGTTGACGGTATCACC
AATCTCAATGAGAGGTTCGGTTCGCCGAGTTCGCCTAGTCGGCGAGCTTCATCTCGGCGGTACAACAGGCCGTCTTCGCTGAGTACAAAGACTTCTGCGA
CTTTGCCGGCATTCTGAGCTCGCCGGTGTGTAAGGTCCTCAAATTCGCCTCTCAGGTACGCCTTCAGATCGGCCCACCTGAGTTCTTCATCTTGTGCCTT
CGCGATTCGTCGTCTCCGCTCAGTCTGTACCGTCACTGGATCAATGTCGTTGGCATTCCTAGCTGTCTGGGCTGACCGAAGTGGCTGAACATGCTCACGA
ATCATCTGCGACCCTGTTTCGACATTCGGGGTCGTGTGGTTAGTCCGCCGAGTCGACGCCCTGCTGACTTGTTCGAATTCATCTCCACTGCTTTCAAACG
CAGATTCTCCAGGATTTGTTGATATGGCTTCGTGATCCTGACTTCCTCCTCTTGCTCTAGCCGAGTCTTCATCCAGCTTGTCCTCAAAGTGAACTCGGCG
TACTCGGCTACAAGTGACTGCCGTGACAATCGGGGTTTCCGCTGGGTTGTCTGTGGCGTACAGTTCTTCGGCTACTCGGTTAATCATTCTCAGTTCTGCT
TTCCTATCCGTCCCGAGAATTACTCGTCCAGCTTTAGCTTCAAGGGCTTCTGTAGCGAGAGAGTCAGCCGCTGCGTTATAGTGTCGCGCTATGTGTCGAT
ACCGGACCGAGTTGAGTTGCTTCGTGAGATCCTTGTGTCGAGCTAGCTCCACTTGCAATGTTTCCTTCTTGCATGCTATCACCCCCATGGATTACTGGAT
TGCAAGCCGGGAGTCACCCACGATAATCAGATCGGTTATCCCTCGGTCAATCGCCGCCAAAACTCCATTGTTCATGCCGGTATACTCGGCGATGTTGACT
GTGGTGGACGACAGGTACGCACTCGCAGCGATCTCAATGTCCCAATTCGGAAGGCGCCACAGTATCCACGAACAACTTCCATACCCGCCATACTTAGCCG
TCTTCGCTGAGCCATCGAATGACAGCACGCATCCTGCAAAGTCAGCTGGTATTCGGGCGTATAGCAGCGCTGCGTCCATTCGAACTGTCGCCGAGTTCTT
GGAGGGAGGCGCAAGGTGCTTCAGGGAATCGTCGAGTCCGATAAACGGGGTTATCGACGCCTGGAGCAGCTGGGCGAAGTCTACATCTCGTTCACGTACT
CGCTTCACCTTCAAATCGTAGGGCGACAACATAACTGCGAAACTGACTGCGCGACCGTACAGCGACTTTGACTTAAACACCCACTCCAGCGTGGAGATAC
GGGTGTAGACGTGAAGCGTCTTTCCCGCCAAGAGAGTGTAGCACACTTTCAGCAATTGCAACAGCGCGACTACTTCTTTCTCAGCGGGATGATAGCCGAG
TTCGTTCTCCTTTAGTACGCGTCCGTAGAAGCGAACTGGGTGCAGCTTGTCGTCGTGTGGTTGCATCAACGTACTGCTCAGTGCCCACTCATTGGCGTAC
AACATTATATGGACTTCTTTCGCCGAGTCGAAATGACGCAGAATTGGAGCTTCTGCTACCCGTCTTTTGAGCTCGGCGAATGATGCTTTTGCTGACGCCA
GGTCACCCCCAGGGCCAAAGTCCGTATCCTTGAGCTGATAGAGTACTGCTCCGTAAACAGCCAAGTTCTGGATGAATCGGCCGTAATAGTTGAGGGCACC
GAGGAAAGCTTGCATCCCCTTCTTCGATTTCGGGAAGGCGAGCTCGGCGATCGCGGCTATCTTCTTCGCATCAGCGCGTATGCCACTCGGCGTAATCTCG
TGCGATAGGAAATCAACATTGGGTTGGATAAAGATACTCTTGGTAAAGCTGATGCTAATTCGACATTCTGTGAGCCGGGCTAGTAATCGGTCGAGTGTCC
CCAAGCAGGCGTCGAACGTCGCCCCTCCAAACCAGATATCATCGACAAACGACCTCCGCTTAAAAACTGGAATAAAAAAAGACTGGTCTGGTTCTCCATT
AGCAAACATATCGCCGTCCGGTCCGTTGACCGGGTCTTGGACCGGATCGCAGTCAGCTTGTGATTGGTGGTCAGCTTCAAACTTCGTCAGCTGACTCTTC
GTTGAATCGCTGACTCCGCCGAGCTCTACTCGCCGAGTCCCCGACTCGGCTTCAGCAATGGTCATCCGTTCGGCAAACAACTGCCATCCTCCCTTTGGTT
GAACGTATCCCCATAGAGCGTTGTCGATCAGTCGCTGGTAAATCATAGGCGCATTCTTCAATCCAAACGGCATTCGTAACCATTCAAAGTGTCCAAGTGC
ACAGACGAACGCTGAGATCTGCCGAGCTCGGCGTGTCATCAAGACTGCCCAGAATCCACTCGCAGCATCGAGCGAGCAAAACCACAAGTAACTCTCCAAT
TCGGTAAGCAGGTCATCGACCAGTGGCATAGCGTATTCCATCGGCGTCGTGACCGCATTAACCAGTTTATAGTCAAAATGCATAGCCGAATATCCACACC
ATTTTTCTTGAGCACTATCACCACTGGCGAGGCCCAAGGGCTGCCCGAGAACGATATCAGCCCAGCTCGAAGTAGCCCTTTCAACAACTCGTAAAGTTTG
CTCAAGTGGCGGAGAGGTATCCGCCGAGCTCTCTGCTTTATGGGTGCGTGCCCTTGAACGTCGATGTCGCACAATGCTCCGTACGCTGGAGGCGGCAGGG
CATT