Description :
From Genome Similarity Track
Location :
Scaffold_116:5372- 6711
Sequence
1339 bases(100 bases per row)
AAAACGTCAATGGCGTATGGGCTATCGTTCCGGAGTGGCACCTTAAACTCCCAGGAGTTTTCAGACGCAGGGCATCGGCACCACTTCACCAGAAACTGGT
ATTAACCTTAGTAACCATGCTGCGTCATTATATTCTCCACATATATCTGTAAGCTAACTTTCTCATCGGGCATCGCCGAAGACGGTCAGTGTATCGGTAG
AGGCTCATGTAGAGCTCTTGTCTGAGTTGTCGCGTCTCCGTAAGAAGCTTGGTCGCATGCATGGTGCATTTAGTCAGTCTGAGGCTGAGATAAAGCAGCT
CCGGAAAACTATTGCTCAGGTGCACAGCGATCATGGACAGTCATCGACTGTGCTGGCTTAAATTCGTAAAAAGATGAACCGCTTCGGCTCAATCGCCTCG
GTCAGCCGATGCCTTCGGAAGTTGGGGTATACCTTGTTTGATGGCTAGGTAGAACGCTTGATAAAGATTCATCTATCCTGGGCAAAGTTCTTCTCCCTGG
CGCAAACGCCTCCAGGTCAACAAGAAAATGATCCTGATACGGCTTGATTAATACAGCGTAGAACACTGGTTGTGTGCGCAGCTTGTGCGGTAGGTTAAGC
GTATGGTCAAAGCCCATCTTGACCACGACCGTGAACGGCCCAATGAAGTGTGGACTCAAGACTGTCTTGAAGACGGCAGGCAATACATTTGCAGTATGGC
TTTTGCGTCTAGTAAGGCTTGGTTTCCAGCCTCATAAGAATCAATACATCCTAAGCTTGTTCCGCTTTTATGGCTATGATTCATTGCTTTACGCACATGT
CGTAAGACACTAACGCGCGTTTAGAGGAACTCGCTTCCCTGTTTTTGAATAGTAAGAGGGCTAATATCAGCAATCCCGTAGGCAAACCCTCCCCCACAAA
GCTCAGAACCACGCCTTGGTATCGTTAACGGGACGCTCGGGTGTCTTAGGCTATTCACGTAAAAAGTAGTAAAGCCGGTCGAGGCATGAATGGCGTTGTT
CAACGCAAATTTAACAACAGGGAGCATCCATATCCAAGGTTTTGGCGACTCAGCACAAAACCTGCGAAGAAGATCTCCGACGACGCAATTAACTTGCTAA
GTTCGGCCAGCGATCTGCGGTCGATCTACTGTGTTTACGTCCAATGGGGCGCCAAGCACCTTAAAGATGAATTCCCAAACTTTCCAGTAAAGCGGGGATC
TCTATTAAAGATAATTTACCACCCGCAAACCGTATTGATATAACGAACGATCGATAAACAGCATAGCTGTACCTTTCCCATCGATGGAGTCTGGCACAGC
CTCTAAGTGAGACATCTTGCTCAAACGGTCAACAAAAAC