Description :
From Genome Similarity Track
Location :
contig_15:537199- 546232
Transcript NameFunction/comments
g4090.t1XP_009517061.1 hypothetical protein PHYSODRAFT_309959 [Phytophthora sojae

Sequence
9033 bases(100 bases per row)
CTTCACTCGGCACCGGGACGAAGCACCTTCGTAGGACGAGCTGCTGCCGACGCGGAGCCCTTGAGCACGGTGTGTTTGCGCTTGCGCAACTGCTTGGTAC
GACGCTTTTGCTCGTTCTTCTGCATCCGGCGCTGGGCTGCCCGCTGCGGGTCGGCCACTGCTTCGGTGCGGCGCTGAAGTTTCCGTGCGGCGCGACGCGA
CGCCATCTTCCTCTGCACGAACGAGTAGGCCTCCAAGAACGTCGCCGCTCCCAGCTTTTTCTCCAGAAGCTGCAGCACTTCCTGCGCAAGTAGTGCGCTC
TCAGGTGGTGCCACGGACTCCGGTGCAGGACCGCTCCTTCGGTTCTTGTAGCGGTTGCGCTGTTGTTGCTGCAACCGCACCTGCTCCTGCTGAGCCTGCA
GCTCTTCCAGCTTGCTTGAAGCTCGATACAGCGGATTGATGATCTGAACAACATACTGCTCGGCGAAGGCCGCGTCGTGGCTGTGCAGCAGAGCGGCGAA
CAGCTTGAACACCACGGCTTGCACCTCGTTGCTGCAGCTTGAGCCGCGTGCAACGTACGAGAGCCGCGTAAGCAGCCAGCCCATGGGTGTACTTGCCTTT
GCGCGCTCCTCGGTCTTCTCCTGCTCCTCACGACGCTGCAGTTCCGCCTCGTCCTCGTCAGCCTTCTTCTCATCAGTGGCAGTGTCCTCCTCATCCCCAC
CCGCATCCTCAGCTTCAACTTCAACGCTTGTGGCATTCGCCTCGCCATCCTTCACGGAGTCAGCAGCGGCAGCCGTCACGTCCTGCGGGATATCGGTTGT
CTCAAGCGCTTGGCACAGGAACGGCAGCGCTGTAAGAACCTCGCTAGTTAGCTCGCTGTTCAGTGCCGGTGCCTCCAGCAGCTTGCAGAAAGCACTAGCC
CAGATGAACAGACGGCCAGGACGCTGCAGATACAGCGCTCCATTCTGCAGACGCTCCAGGGCATCTCCAGATAAACGCTTCACCGGAGCTGCAAAGGCAA
GCGTGCTCGCTTGGCGGCGGCTCAGATACGACGTCAACAATCGGGTTGCGCCAAGACGCACCCAGGCGTGGGGGTACTGAAGCAACGGCAGCACCACCGC
GTCCAGGAAATTCGTCGACACCTTCAACTCCTCCAGCCAAAGCTCGTAGGGACCAGCAAGATGGTCGCTGAAGGCTCTAAGCGCGACACAAACATGGTAT
GTCGGCTGCCACCGCACCTGATCACTGTCCTCCACAGTCTGAAGCTCATGTAGACTGCGCTCGAGCGCTGTGCGCGTCGCAGCCAATACCTGAGGCGCGC
TGCGCTCCATGAATTCGGGTCGGGTTTCCAGCACAAGCGTCGTCACCTGAGCTGCAGCCCCGAGTAGCTTCACCGCATCCGCAGTATTCGAGTTTGCTGC
TTGTGTCCACCACGTGCACACCAGCAGAATGCTCTCGTTCAGCTCCTTGTTGCCAAGACGACGCACAAGCGTGCTCAAAGCTGCCCGAGCCAGGTCACGG
CACTCCGAAGCCTCGTCGTTTGCTAACCGTAACACCAGCGGCAAGAAGAAGAACTGGGACCGAGCGTTCACCAAATCCTGCGGGAGCTTCGTGAGAAGCG
AACGAAGAGCCTCAAGTACGGCAGCGCGTCCAGTAGCGTGTCCGTAGCTCAGGTTGTCCACCAAGAATTTGAGGTGACGAGACAACCGCTTGTTTCCAAG
AGGGTACTCAAGCAGGAATGTCTGGTAGATGGTTGCACAGTTTAGGCGCGCACCCGGGGCATCGCTCTGAACAAGTAGCTCGCCAACACGCAGCATCACG
TCGTACACCTCGCTCACCACCAGATGAGAGTTCACAATGGCCTTCAGAAGGGCGAATGTGGCGTTCTGGTGATCTTGCTCGTCAAGATCGGCTCGCAAGA
AACTCAGAAGCACGCGAAGTTGCGGTTCCGTCAGACGCAACGCCTCGTTCTTCGAGTCCTTGGGCGCGTTGCCGTTCTCCTGTGCGAGTTCCAATCCTTG
CTGTTGTCTAAGGAGCGCAGTAAGGGTGCGGTAGCATGTCTGCACCATCTCGTTGCGAGTAGCAGCTCCAGCCTGCTGCAGAATCTTAAAGAGGCGGTCA
AGAAGAGGTGTGCGCGCCACCCGCAAAGCAGGGAGCTCTTCCTGTCGAGGGAGCATTGAGCCAACGCACTTGAGCGCGTTGATAACAGCTCGGTCGTTCT
TTGACTCGCCAGCGCAACGCATCAGCAGAGGCACAAGCGGGTCGACGAGCTGGGCCGGAGCGTCTGAAATCTTCTCTGCGTCTTGGTTCTTGGAGCTGCC
ACTCTTGCGGAGGAAGGTGAATACCAAGAAGACACCAAAGTTTAGAAGCTCTCTCAGATGAGCGGTGCTCTCGGCTAGCAGAGCAGCAATCGCCTCGCGC
TTTTGCTTTTTGGTCTTGCTTTGCTGTTGCTGGCGCAGTTTATCAAACCCAGTGACCTGTTGCTGCATCGCAACACGTACAGTGTCCCGGGCTTTCACTC
GTGCGGCAAGCAGTTTAGTGGCTCGCGCACTCTTCTCGGACACAAGCCACGAAGTCACCAGTGCCGTGCTGCTACCTGCCGCTTCGTATTGCTCCTTTTC
CCTCTCTGAAGTCGGGCGCAAACTCTCCAGGCTCGAGTTGAGCACATTGTACGCGTAGAGGAACATGTAGGACGATTCCACAGAGGGGTTCTTCGCAAGG
CCAATCGCTATGCGCTTCAATGCTTCCTGCAACGCGGCCGTAGCTTGAGCCCCAGCGTCTGTCGCCTGGAAGCGCTTTACAAGAGCACTTACGACCTCGT
GGATGCTTGGATTGGGCAAGAACGGCAATGATCTTGCCAGCAACTCCAGCGAGTCCAGGCTTCGCCCACCGCTCGAGCGGGCCTCCTTCATCTTGGATTT
TTGAGCCGATCTCCGTTCCACGCCTCCAGCAGCAGCCTCCGCGGCCTCGCCGATGGTAGTCATACCCTGGAATAACTCTGCGGCGAGAATCTCCATCAGG
CTTGGCACGCAAGCATCCAGAGGGGATGCAAATTCAGCCTCGCTCTCGGCTTCCTGCTGCTTGTCTTGCATAAGCAGCAATGATTGAGGCTTCCGAGGTG
GGCCGGCGTGTCCTTCACTCTGCATGATCTCGGGGAGCTTTTCCAACAGGGCGTGCACCGTAAAAGACAGCACATGGACCATGTATCCATCGCGCAGAGT
GTGGCGAAGCTCCTCCACAATCGGTAGTAGGAAGCGTGCACCAAGCTCCACAGCGATTCTAACCAGCGTGGTACGAGCTGAAACACGCACAGCTTCATCC
TTATTTTTCAGCAAGTTCGCGAAACGCAACAGCAGCTTGGGTAGCTCACGTTGGAAGGTCTCAGCCCGCAATCGCCGCAGCACCTTCACGACAGCCAGCG
CGAGAGGCACACGGACAGAAACAGACTCCTCGGAGAGCGAAGATGGCTCGCTATCGTTCTCTGCTTCTTCGAGCTCTTTTTCGAGCCCGCACTCTTGAAC
AGATATGAGTAGAGCATCGGAAGAACTTGTGTCTCCATGTTATCCTGCACCTTGGAGGATCCGTCTTCATCTTTCTGCTCAGGCTCGGAGGGGTTGCTGT
CAGTGTTCACCTTACTGGACGACAATTGCCACTGAGTAGCCGCACCCGGCGCCTCGAAGTGAAAGTGGTCAATCACTGCGCAAATGGACATAATGATAGC
GCCTTCCATTTCAACATGACCGTCGATCGACTTCAGCAGTCTGCGAAGCAGTGACAGGTAGTGCGACCAGCTCAACAGGCCAGCAGCACTGCCTACGCAC
GCTGCAGCTTCAGCGCGCAGAGACTCCTGGCTCTTTGCGTGTGTCTCGTAGACAAAGTGCAGCACCAGAGGGAGGATGACACCATTCACCGTCGAGTTCG
AAAAGCACACAGGTTCTCCAATTTCCTCACCATCAACTTGACCCTGGGCCTTACCAGCCATGGAGTCCATGAGAGCGCTGAGACGCTGAAGGGCACGACG
TCTGCGGTGAGCTTGAATGTGCGTAATGTTGTAGAAAAAGTCAGCCTCTGGGTCCTCGTGGTTGCGCGCCAGCACCAGATCTGCTGGAATAAATGCAAAC
TGTCTAAATGCCTTGTGTTGGTCCGCCAACGATCCCAACAGAGTCACAAAGCCTCGCCGCGCATTCTCATCAGTCGAGCGCAGACTTGCCCGCACGCAAG
GCATCACCAGCGACTCCAATCCATTAAGCACAGGAGACTTCGCGGCATCGTCTTGCCTGCTCTGCTCGACTGCAATCTCTGCTGCTAGTCCCAGGAACAC
CGTAAGGCTGGCAAGCGCAGCGCTGCGCACTGAGAATTCAGCGTTGTGCATGGACTGCAGGCACTGCGCCACCAGAGGAGCTAGCAAATGAGTCTCGTGC
GTAAACCCGTCAAATCGTGTGGTGTTAAGGCGGTTTAGCGCAATCAAGCGACGCTCGTAGTCGGTCTCCTCGATTTGCTTAGCGTCGTATGCGTTGAGCT
CATCCAGCAACTCTGCCACGGGCGCCAGCTCTGTAAGCGCAGGATGCGCGCCCAGAGCTGTAAATACCATTACTAGTTTCAGGCGGGTATCACGATCGGC
AATGCAATTCGGACCTGGAGCCAGCAGCCGTGCAAGGGCGAGCACATGCTTCTTAGGCTCCGAGAGCTTCGGCACCAAGTGGGCCAGCACCTCCAATAGG
TTTTCCTTGTCCTTAGGCGACGTCTGGTGGTTGCGCAGCAAGAATGGCAATAGCAGCTGAAACAGATCGTGGGCAGCAATTGCCACGTCTCCGTCAGAGG
CGTCTAGATGGTGCGACAGCCGGCAGAGGAACGTAAGCTCCTTTCGAGATGATCCAGCGTACCGGTCGCTTGCGTAGCGTGCAGCCTTGGCCTGGAACCG
CTGCACAAATTGCTCCAACACGAAAGGGATGTGGCTCACAGCAGCACCTTGTCATCCTCCTTGATGGCAGTCATAGCTCGTCTTCGGCCAACACACTTTC
ATCTCCATCCAGCAATGAATCCATAAACTGCAGGATAGAGTCTAGAATTTCAGGCGAAATGCCACGACTAGATGCGGACGACACGCTCGATGACGTCAAT
CCTGCCGACAAGCATGAGATAACGCTTAGCACCAGAGGCTCCGGGATCCACTGACGTGCCCTGTCGGCGCGACCCATTGCGACGAGCAATTCCAAGAGTG
CGGAAGCCTTGCCAGCACCGACAACCGCGTTGGACAAGTGCACAACGGCATCATGCGAAGTTTCCAGCACCGCTTCTACCCAGGGTTGGAGGCGCACGAG
CGTATCAAACTTCATTAGCAAAACATAACAATGGTTAGTACTTTAATTGAACAGTGGATTTGAGAAACCAAGCGCCGTACCGTGTCGATCAACTCTGCGA
GTCGGCGGTATGTCAGCATGCGGATCTGCTTCTTCATCGAAGCAGATGTCACTAGGCTGTCAACAGTCGACGAGGGCTCACCAGCTTTCCGCTTCGTGCC
CACAGCAGCCCCTGCGTCCTCCTTGTCATCATTATTTTCGCCAGTAGTAGCAATTTCATCGTCATCTTCGCCGGAAGCTATACTGATCTGAAGAATAGCC
AGCAACACGTCTGCAAGGCGAGGCGCAAAAGCGGCCAGCTTCACGCCAAGTTGGTTGATAAGGTCCTCGAGCAAATTCAAGAAACCAAGAATGCGCGAAG
GCTGTACATTGGAGACTGCTACGACAGGTTTCACGTTGTCAGAGATAATAACAGTGTCTTGAGCAAGACTCTCGGGGCTTCAATCGATACATCAAACGCA
CGGACCACAAGTTCCACGAAGCTCGCTAGCTCGGGCGCCTCCAGCGCTGCCAAATATGCTAAGATGGCTGCACGGCGCGCAGCCACCGTGTCACCATTGT
TACGGCCCTTCTTGCTCACGCATTTCGAGTACAAAACGCGCAGCAGAACAGGGAGCAACTCAGGTCGGTGCTCGCGAAGCACGACCCCCTCTCCGTCGCC
CACCTTAAAGCTCGCCAGTTCTTCGCGGAACGACGAAGAATCCGTCAGCCGATTCAACTGCGTCTTGTAGGACACAACTGCCTTGTTGCCAAACGCGTAG
ATGCACTGCAAAGCAAGCTTCGAAACCACTTCGTCCGACTTCATCAACAGGTCGAAGAAAAGAGCATGCAGCAACTGCTGCCCGTATGCACCTTTCATAT
TGTGAAAGACAGCAAACAGCTTCAGCTGATCAACAAACTTGCAACGCACTTCCTTGGTGGTCAAACCTTGGAACTCAACTGGCTTACGCCAGTTTGGAGA
TGCAGCATCATTCGAACTGTTGGTTGTTTCTTCGAGCTTGACAAGCACCTGGTCAATTTCCTCGAGACGGTTGGCGTCCAGCTCATCCGTGTAGATGGCG
CTATACTGGTCGCGCAAAAATGTAAGGAAAAGCGGTACCATAAACTTGGTTTTGGCCTCCACAAGGTCCGCGAACTTCATAAGTCCCTTCCACATCAGCG
AATGATGAGTAGGAGCATCTGTGACACTAGATGCATGCACCTTGCCCTGCTCCAGCATGCACACGCGCTCAAACTCCTGAGCAACGCTACTTTCGATACC
AGACGTGCTCGATTCACTACCGTTCGGGTCCTCGTGGCAAAGTGAAGCGGCAAGAAGCTCTGCACTGATGCATGGCCAAAATTCGTTGAAATGCAGCCGT
GCTGCCGTCTCCACTGCATCCGCGATGTGTGGCCAAATCATAGAGAACTTGACGTGGTACAGACCCAACAATTGGTTCAAGGCAATTTTCTTGTACAGCT
CCGGGGTCTGTGGCGAACGACACAGGATCTTCACTCGGGTCAGCAGGCGCACCACTTCTCGCTCAGTAGCCACACTGATACTTTTGCATGCGAGCTCTAG
GTTGACGCAGATATCCGGGAGATCGCATGGGCCGCTCAGTGAACCGCTGTCGGAATCAATAAAACCGAGTCGCTTAAATCGAGCCAAAAACTGCAGAGCC
ACTAAGCGTAGCTCATGTGCGGGCGAGCGCAGAGTCGCAAGTAGAGAGTTAGCCAGCGAAAGTAGTGCATCAATCGTTAGAACAGCATGCTGCTTTTCCT
CGGACTCCATTCCAATAAGCATCAATAAAGTCGACAGCGTCTTGAATGACGACTCTTTGCCGCGAATTGCTTGCTCCACATATTTCGTTGTCATCGCCGC
ACCCTTGTTCTTCGTCTGGTGTTTGGCGATCTGCTGCAGCTGCCACAACTCATCGCGCAGCAACTGGAGTTCGGTAGCTGATGAGCCCGACGCAGTTTTC
AGTCGTTTGTCAAGCTTTGTGACTAGAGGAGTAGTGAAGCCGATCATTTTGTCGTCATTCAACTGCAAAAGCTCCAACGCCTTGCAAAATTTCCAGCGCA
CAGCGATATCATCGGAGTCGTTTTCGCTGTTAAAGATTTTCTTACCCGCATCAAATAGTGCCTTCTCAGCGTTATCATCGATTTCCTGAAACGAAAGCAA
CCAGTATTGACTTGAGTTCTTCGAGCGTACAATGTAAGCGCTCTGGCCGTCGTTGATTTCGCCTGCATGGACTGTCACGTAGTCACCAAGTTGACACAAC
AGCACACTGAAAGCACTGACATCAACTTCCACCAGCGTTTTAAGTGCAAACTCCATAGCGTTCGGTAGCAAAAAATCAATGACAAAACCCACGTCGACGT
GTCTGTTGTGCAGCTCCTGATCAACAAACTCCAACAGCTTTTGACGCCAGTACACTTGCTCGTCCTTCTTCGCTGCTACTGCAAAAATCGCCTTCACCTG
GGTCGAAATCACATCGTCTTCAGCGGGGAACAGCCGCCACACAGCCTCAAAAGTCTGCATGAGTACGTCCCGCAGGGCATTGCTGCGGGACGTGAGAACC
TTGTTCTCAGGAGAAACCAGCGCTGCACAAACCTTGTGCAGGCTCGGTACGCGCACCTCGTACGCGTTACTAGCGCCCGAAAGCAGACTACCCATTCGCG
AAATCAAGAAGCCAAGCAGAACGCTCAGTACGCGGCTCAAATACAGATCGTCCGCGTCAGTAGGGACATCGTCTTTCTCATGGCGAATATTCGCCACCTT
GTTCACTACGAGTACCAGGCACTCGAGCATCTCGCCCGAATGGTCGGCATCCGTGTGCTTCATCATTTGCCCACACGTTTGGTATACGACCTCAAACACC
GCCTCCTGTTGCTCAAGCTGCTCCTGCGACTCCTCTGAATTCTTCGGTCGGAACGCTCCCAGCAAAAACAGCAGCACCTCGCGCATGCGGGAGTGGAAAC
CATGGTTCACATTGCGCACGAGCGCGAAGAAGAGCTTGGCCGACCCATCCCTCAAGATATCGTCGTTCCGCCCCGAGCCCTTCACCAGCGCCGTCAAGTA
CGCACGCAGGTACTTGCGCATCGCCTTGGGGGACTCGATCCGTCTCAGCAGCACGGCCAGCGTCTGCGCTGCAAAGTTGCGGACAAACTCCTTGGGGTGG
CCGAGCAGCGGGAAGTAGCACTTGTGCACGGCGTCCATGTCGGCTAGCAGTTGAACGCGCAGGTAGCTGAAGAGCATCGTGAGCGTCTTGAACACTTGTG
TGCTGAGCTCCGGGTCCTTTGTGTCGATCACAGCCACCACCAGAGGCAAAACTCCACCAAAGTGCGGGTAAAACTCCTTGCCGAGCTCTCTGGCCAGCGC
CGTCACGAGCTTGAGCACGGGCACGAGCCGCTGACGCTGCACGACCGGGTCCGCATTGTCTTCTCGTGCGTCTTTGAGCTCCTTCTGCAGGCGCTTGATC
ACCTTGAGAGGTGATGCAGCAGTTGAGGAGTGGTGGTCACCAGCGGCTGCAGTGCGCGGAACAGGAACTGGAAGCTGTCGAGCGTCGTGAGCTCCGCCTG
CAGACTCAGTTCCTCCTTGAACGAGAGCACGGAGGCCTCGTCCACGGCGCCCGTGCTCTTGGCATGCAGCGTGAGCTCCGTCTGTAGGTTGCTCACGCGC
TCCTCCACCTTCTGGAAGCGGTGGCGCCGTTTC