Description :
From Genome Similarity Track
Location :
Scaffold_5:537195- 541502
Transcript NameFunction/comments
Phyin_T30-4PITG_04073Putative uncharacterized protein

Sequence
4307 bases(100 bases per row)
GGTTAAAGCGGAGACATTGAAGAATCAACAATCTTTTGATCTCTATCAGTCCATCCGAAATAAAACCACACCTCGAGTTGGAAAAGGTTCTTTACGCAAG
AATAATGGCGAACAAAGCAATGGCAAATCCCAAAAGGGTGAGGCAGCACAATCGTCGAGTGATGATCGGCCTGGATCCAAGAAACGCAATCCTGCCTCTG
CCCAAGGCTGTTTACACTGCAAGGGTGTCCATTGGGTGAGCGATTGGCCTTCTGCCAGTGAGGAACAGAAGAAGACAGCTCGTCAAGCGTTCATGAACCA
GCGCAAGGGATCTGAGGCGTTTAAAATGAAGCGTGTGCTGGAAGATGACGAATATCTCGCTCCGAGGCATGTTGCATACAATGGGGTGGTGACTTTTTTC
TTTTTTCCAGGACAATGGAAGCAAATACAATGTAATTCCTCGCCGAGTAGCTAAGGAAGCTCTCCAATTATGCCCGGATGTAAAGGTGGAATGTCTTACG
AAGCCGATTGATGGCAAGGCTGTAGGTGGAGCTATTAAAACCAGCAAAAAATCAATTCAGCTGGATTTGGAGTTAATTATTCCAGCAGGGAGGGCCCGAA
TGCGCCATATGACCTGTATCATTACGGAAACAGAAGAGGACGAGTTCCTGCTAGGAAGGTTGACGCTTGAGGCGCTTGGAATTTATGTTGAAGGACTATT
AGCGGTATTAGCCAATAAAGAGATCGATGATTTTGAACCTTTCGAGTCAGAAACTCCGGTGAGCTTCAATCCGCCTGACAAAGGGAGAATTATGGGACAG
CTCTGTGAGCTAATTAATGAAGCTGTCACGAATGGATTTCCTGTTGACCGCAAACGTGATCTCTTTGATGGGCAACACGGTATGATATTTGGCGCCTGGA
AATCGGCAATGACCCGCCTTCGAAGATGGAGTTGTTCGACATTCAGTTCAAGGACAGAACTGTGCCTATACGATGCAAACCTCGAACGTATACACCAGCA
GCGCGAGAATAGATGAGGTCATTTAATGAATCTCGTGTTTCTGTTGGGTGGGTGTACCGTAACGAGGCTAGTAGATGGGCCAGTCCTGCACGACCTGTGA
AGAAACCGGGAAAACTAGGTGGACTAAGCCAAGGTGTTGATTTCCAGCATGTCAATGCACAAGTTGTGCCTTTGGCGGGTGGAATGCCCAATTTAGCCAC
ACGTCTTTACCATACAAAGCAGAAGAAGTACAAGCAAACTGTGGATTTCTCGAAGAGCTTTTGGCAAAAGGCGTTAGCGTCGTCCAGCTAAGCGTCACAG
TCTTATATGACGATGGATGGCGTCTTCACGCCTACCCGCCCTTAGCAAGGTGGCGTCAATTCTTCGATCCACTTTCAGCAATCAATTGAGAAGATAATGC
GCAAAGCCGGACTACTATACGAGAATGGGTTGGCATGGATTGATGATCTTCTCGTCTACGCGTCCACTATAGATGAAATTTTGTCGGTACTGGACCTTGT
ATAAAGCACTTTGAAGGAATCTGGACTATTTCTCGGGATGAATAAAATCTTCTTGTACACAACCGAAATAAAGTGGTGTGGGCGAACTATTAAGGTAGAC
GGAGCTGCCTATGATCCAGATAAAATCCAACCTTTGGGCAATCTTCCAGAGCCACACACGGCAGGCGAACTATAACAGTTCTTGTGCGCGGCTGGGTGAA
TGCTTAATTATCTCGTTGATTTTGCTCGGGTATCTGCACCTCTGTAGGAAAGGTTACAAGCTGCCTTAGCCGGTACAAAGAGGACAAAACACGTTGCTGC
ACGACTAGTCATTGACCTCTCTGAACCTGAGCGGGATAGTTTTAAGCTAGTCAAATATTTGCTCACGAACTCAGCGACACTGGTAACACCTGATGACGAC
GAGCTCATTTTGATGACCGATGCAAGTGCTTTTGGATGGAGCATTATCTTAACAATTGTTGCGGATTGGGATTCGTCGATTAACATCGCGGAACAGCATC
ATCAGCTAGTGCACTGCATGAGCGGTACTTTCAAAGGGTCTTCACAGCACTGGAGCGTCTCAGAAAAAGAGGCATTTCCAATTATTAAGGCTGCTACGGA
CTTAGACTATCTGCTGATACGCTCCCAGGGTTTTTGCTTGTACTCGGACCATCGAAATTTTATTTTTTGTTTTCGCGTCCGGTGATGAGATAAAGAAGCG
TGTTAGGGGAAACAACAACGCTGGAGCCTGAAACTAAATGAGTTACGGTACAGCATCGAACATATCAGCGGTACCGACATGGCTTCACGGTGGGCTCGTT
CGACATCATCACCTGAATCTACTACTATCAAGAGCTGGCAGTTAGAAGTAGAGCAACAACCAGTTGAACTACGTCCTCTATGATCGAATTCCGAGTGGTC
TACCATTGTGGACATCCAAAACGCTCAGCATGCAACTGAGTGCACCCGTCCAACGGATCTCAGTAAACATGACGGAGTCTGGAAAGACACGAACAACCAC
GTGTGGATTCCGGCGGATGCTGAAGTGCTCTTAGTGCGATTAATGGTGATCGCCCACTGTGGCACAATGGGCCATCGGGGGGGGGGTAAAGGTAATGGTG
AATCATCTCAAAGATCACTTCCACATCGACAAACTAGAGCAAAAGGCTCGTGAGTTTTGCCGTCGTTGTCTACTGTGCTGCCATATGAAGGGTGGTTAAA
TTGTACCAAGACCTTGGGGCGAGACGTATCGCTCTAAAGAAAGTAACGAAGCACTGCACATGGATTACCTGTACATTGGAGAGTACAAGGCAAAAACGAC
TACATATTGGTAATGAAGGAAGATTTCTCGCACTTCTGTGAGCTGATCAAGTGTACTAGCGCAGATGCAGCAGCAGCTGCCACATAGATTCTCACCTGGA
GCAGCAGATACGGAACGCCGGAGCTGATAATAAGCGACACGGCCACGCACTTCAAAATCCAGCTTCTAGAGGAACTTTGTCACAAGACTCAGATGAAGCA
GAGCTTTACGCTCGCCTATTGCCCGTTAGTTAATGGAAGTGTCGAGCGACTGAACCGAGATATCTTGCAGGTTTTGCGTGTCATGCGTTTGGAGCTCAAT
GTTGAACAAGAGAACTGGGCTGCGCTTCTACCATTGATTCAAGCAAACCTGAATCAAAGCCCGGTAACGTCACTTCCCGACCATGCACCGGCGGAAGGAT
TCCTAGGGGTTAAAGCGACAACCCCGTTGCAGAAAGGCCTACTTGGTACTGATGCAGTTGCGGCAAATGTATTGAATGTGGAGAACTTAGTGCCCAACGT
GAGCCAAGCGGCCCAAGAGCTGAGATCGTCGCTCCTGGACATGCACCACGATGTTACAACAGCAAAGAAAAAGAAAACCGAGCGCAACAAAAACAATCAA
CGAAGTGCAAGAGCGTTGAATTTCCATGTTGGAGATTATGTTTTGTGGTCCCGAGTCGACGCAAAAAAGCAAGGCAACAAATTATCGGTGACGTGGGTGG
GACCATACCGTGTGATTAGCGCCAATGCCAACTCGCTCGAAATCGAACACTTGATCATTGCGAACCCGAAAGTCATCCATGCTTCACGTCTCAAACTGTA
TGCAGATGAAAGTCTTGATGTCAATGAAGGTCTTTTGGAGCGCATTGCAAACCAGGATGTATACCTCACTGTGGAGGCATTCACGGAGCACCGCAAGCAT
CCGACGCATACTTTCGAGATGCTGGTTCGCTGGGAAGGCCTTGAGGCTATTGAGGCCTCTTGGGAGCCTGTTAACAACATGTTCGAGGATGTTCCTCTCA
AGTTGAAACAATATGCGGATACTGCCGGGGGTGCTGCATTGAGTCGCTTCGTTTGCAACTCACGATCAGACCGTCCACTCAGAAACAAAGGAGCCAAACA
GCAGAAACAAGGAGCTGCACAACAACGCTAACAAGCACCGGCCGTCGTCGGCGTACAGCTAAGGCCAATACGAAGGCGTAGGACATCTCCCGTTTGGCTG
GCCGTATGCAAATGTCTGTTTGAAGGGCGGTGTAGTGGTTTCCCAGACACTTCGCATAGAGGTTACAGATCACAGAGGGGTTACCGACGACAGGCGAGAA
GCATGAGAGCATGGCGAGCTCTCAAGAATTGTATACAGCATAGTCAAGGAGGCATTGAGCATAGTGAAACAAACAGAAACCAATACGGCAGCCGCCGTAG
CCCCGCATTTAATAACAGAATTCTTTTTATCTCCAAGTACACGAGTGGGTTCTCAACTAGCAAGCATTTAGGGTCGCACGACACTACAGTGGTGCTAGAT
GGGAGCA