Description :
From Genome Similarity Track
Location :
Scaffold_10:53713- 54920
Transcript NameFunction/comments
Phymu_g779hypothetical protein

Sequence
1207 bases(100 bases per row)
GGTATTTGCGAGAGCATTTGAGTCAGACACATCCCTTGGCGCCACCGCAGTACATTCCGAGCCCCATCGCTGGATTATCCGTGTGTAATTGCTCACGTCG
GCGCCGCCACTGACAGGTATCCATCGCTGCCTCAGCGAATCGCGGTAAACAAAACTCGTAGAAGCTTCGATCCCCGCCTTCTTTCGCGGTCCCCATgtcg
ctacatgtacaacacTCGtacgatgctgcagctgatgtCTATCACGCGCGTTACGCAATGGATAGCGATCGCAACCGCTTTGCTGCCTGCCAGGCAGTGC
CTGGTGCGATGGCacccagcagcaaatgggcGCTCTTCATTCGATCGCATGGTCGTTGGTGCCGCTGCATCGCTATGCTTTTGTTGGCATCATTGTAATT
GTTATGCTTTGCACGTAATTATGTTTAAACACAAGATATGTGTACGGCACATTAAATTATTATTTTTTACAACAGTTCAGTTTATTATCCGTCATCGTGG
CGCAGTGTCTCACGTTTTGCTTCCGTATCCCCCTCACTTTGGGACTTCTCCCTTCAAGCAGCTGTAGCAACTTCACTATGGGGAGACGAAAGCCCGCGGC
GGCCAAGCACGCGTCGCTGTTCTCGGATGAGCGCGTGGTCGTGGGCGTGgacgacctggtgctgctgccgtctgTGAGCGAAACCTCCATCCTGGAGAAC
CTCAAGATGCGCCACGCCGCTGACGTCATCTACTCGTACATCGGCCACGTCTTAGTGGTCGTAAACCCTTATAAATGGCTCGATATCTACGGCGAAGACA
GCATGCGTGCTTACATGCACAAGGCACGCATCGACGTGGCTCCACACGTGTTCGCCACGGCAGAGGAGACGTACCGCACGATGCTCAGTGAAGAGGACAA
TCAGTGCGTTATTATCAGCGGAGAGAGTGGCGCCGGCAAGACTGAAGCGTCAAAACAGATCCAGAACTACATTGCAGGCGTCAGCGGCAGCGGTACGGGC
GTCGACAAGGTGAAAAGCACATTTTTGGAGAGCAatccgctgctggaggcctTTGGCAATGCCAAAACTCTTCGCAACAACAATTCCAGTCGATTCGGCA
AGTatttcgagctgctgtttgacTCAGCAGGAAGACCGCAAGGCGGTAAAGTGACGAATTACTTACTGGAGAAGTCACGCGTCGTTAAACCCGGCAAGGG
AGAGCGC