Description :
From Genome Similarity Track
Location :
Scaffold_1:5370856- 5372009
Transcript NameFunction/comments
Physo_323445Avr4-associated TDF-like protein

Sequence
1153 bases(100 bases per row)
CAGATCCTCACTCTTCAATTTACCGGAGACCGCACCACAACACCCTCCACCACTACAGACAACCGCTTGCATCGCACCATGAAGCCCTTCGCACCCGTCA
TCGCTGCCTGCTGTGCACTCCTCGCGTCCACCTCCCTCGCCGTCCAGGAAGAGACCAAGTCTCTCGAGGAGCTCTACGCCGACGCTGTCGCTGAAGGAGG
CAACCTCGTCATGTATCACGGCGGAGACTTCAAGTCGCAGCAGGACTCGCTGCACGAGGCCTTCACCACGGCCTTCCCGGAGATCAACTTCACGCTCATC
GTTGACTATAGCAAGTACCACGACGTGCGCATTGACAACCAGCTCGAGACCAACACGCTCGTTCCCGACCTCGTCGCGCTGCAGACGCTGCAGGACTTCC
CTCGCTGGGCGCAGGAGGGCAAACTACTCGAGTACAAGCCCGCCAACTTCTCGCAGGTCTACGACGGCTTCCGCGACCAGCGTGGCGCCTACATGGCGTA
CATGATGTTCACCTTCAGCTTCCTGTACGACGAGACCGCGCTGGACGGGAACGCGGCACCCAAGTCGCCGGCCGACCTCGTGGACCCACAATGGTCAGGT
AAAATCGCATCCACCTACCCGAACGACGACGACGCCGCGCTCTTCCTGTACACGCGCTACGTCGAGAAGTACGGCTGGAACTGGGTCGAAGACCTGGCCA
ACCAGAACGTCACGTTCCGCCGCGGTTCCAATACGGCCAGCGATCTCGTGACGGCCAAGGACAAGGTCATTGGTGTCGGCACGTACTCCGAAGGCACGCC
CAACGTAACGTTCGTGACGGATGGCGGCAACGAGTACCTGGCGTGGGGCCAGCGTATCGCCATCTTGAACAAGGCCAAGCACCCGGCGGCCGCCAAGCTC
TTCATGAACTGGGCCATCTCGGAGGACGTGCAGAAGACGGTTGTGGCCGAGAACGTGCGCGTGGACTTGACGCCCAACTACGGCTCCAGCCACCCGTGGG
AGATCTGCAAGGCGAACGTGGACGAGTTCCCCAAGTTCATGGCGGACCGCGCGGCGGTGGAAGAGTGGAAGCAGACGTTCACGCTGTACATTGGCGAGGT
GCAGGGCGAGCCGACGCCGGGCTTCCTTGGCGTGCACCCTGGTCTGTAAGGTG