Description :
From Genome Similarity Track
Location :
scaffold_104:53705- 55122
Transcript NameFunction/comments
g1312.t1hypothetical protein

Sequence
1417 bases(100 bases per row)
TGTGACAGGCCTCTGTCATACGGGTGCCACCGCGTGTGCGCGGTGGCCAATCAGAGTCGAGCGTACAACCGTTGGTTGGGACGGTCTCGAGTCTCGACTA
CTGCATGTCCACATCAATCAATCAGAGTTCATTTTACCTACTTCCTCGCAACTACAGTGTACGTCGGTAACGGGTTCTGTTAGCCCGTTACACCTGGTAG
CACCTTCGTCGTCCGTTCAACGCCCAAGATCAAGATGAACGACATCTCGAGTATGTCGTTGGAGCACGAGAACTTCCCGCACCTGACGCTGATGGAGTGG
GAAGCACTCCACCGCCTGGCAGCGGTGTCAGGCGACACGGTCGTCAAGACGCTCCTGACGACTGGAACGGAACACGAACAACGCTTGTGTGCTCAAGAGT
TCTTAACGCGTGAGCTCGCTGATCTACGTCGGCGTGCGACGACTCCCACGCCGTCCAAGAACAAGACCGACATCGTCAAGCTCGATGTCTCCACATACAG
CGGCGAAGGCAAGACCCGCCTTCACCTGAACCGCTGGTTCTGCGAGGTGGACATAGCGATCGAAGCTCGGCAATTGTCTACCGAGCTCGCGCGCACGCGC
TTCCTGCTTTCCAAGTTGTCCGGGAAGGCGAAGGAGTGGGCGCTCGGCCGACTCGTGGCCGACGCCTCCTGCTTCCCGACGATGGCAGCTATGCAGGCTG
ACCTGCGACTCGCGTTCGAGCCGCCCCAAGATGAAAGCGTTCAACGGTCGGCATTCCTTTCGCTAAAGCAGGGACGTCTGACCATGCTCGAGTACATTCA
ACGCGCGCGCCATCTCGCCTCGTGTATCACGACGCAGCCAGTCGACATGGCCACACAAGTCCACGTCTTTGTCTCCGGTATGAATGCTGGCTACCAGCGC
TTCTACTTGACCCGCAAGACGCCATCGACGCTGGAGGAAGCCTTCACTGTCGCTTTGCGTGAAGACTATAGTGTGTCGGCATCGCAAGCTTTCGATGTCT
CACGGCCTCTTGTCCCTGACCCAGAGCCCGAACCCATGGAGGTGGATGCTATCCAGTCCTATCGCGGACGTCGGGAGCCGACGTCGCCTTCACGCCAATC
CTCCACTCGGGGGTCGCGTCCTATGAAGTGTTTTCGATGTGGCAAACCTGGCCATCGCGCGGCGGTGTGTCGTGCTCCGTCGCCCATGGCGGCGAACGCT
ACGACTGCGAACGACGTCGCCGCTCCAAAAAACGGCGACGACCAGTAGGTGCGGGGCGCCCTACTGGGTGTGTACGGAGCGATGGTTCTCTGGTGGCAGA
ACCTCCTCCTAGCCCTCCCGTGCTTCACGCACGCCTATCAGCCACCACATCTGGCAGCGACTCGAGACTGATCGTACTCAGTCTCCACGTTGAAGGTGCA
CAGCGCCCAATACGCGC