Description :
From Genome Similarity Track
Location :
Scaffold_13:53703- 55283
Transcript NameFunction/comments
g18301.t1RAW40883.1 hypothetical protein PC110_g2960 [Phytophthora cactorum

Sequence
1580 bases(100 bases per row)
ACGGACCACGCGCAGGCCAGAGGCGAGCCGGACGACGCCATGCTGGGCGTCTGGGGAGACCTGGAGGCCCAGGGAGGCGGCGGCGCGCAATCCGCTGCGG
CCTGGTGGGACATCACGCTGGGCGACGCGAAACCGACCGATACAATGCGCGGAGAGGGCCTTGGGCCCATGGGGCTGCTGCTGGACGAGCAGGAGGCGGC
GCTCGCAGGATTCATCGAGTCGTCGCGGCCTCGGGAGACCATCAGCCCCGTGGCGATCGAGGTGAAGCAGACCCGCACTAAACTGGAAGCGAACGTTATG
TGCAGTGCATTCGCAACTGCGAGACAAGTGCAAGTTTCCGATGATTCGCAAACAGAATCGGAAATGAAGCCCAAGACGAGGAATTGTGTCAGAAAGAAAA
GCGAATTGCTGGTTAAAGTGGAACCGAGTGTCGCAGTGGTGAAGGAGGGGAAAGTGAAGGGGAAACATGCCAAAGTGCAACGGAAACGGAAAGCTGCAGT
GGGGAAAGTTGCCGCGAAGGAGGACAAGAAACTGAGTCCGTTGGAGATTCGCCGCCAACGAAATCGAGAGTCCATGCAACGTGCGAGACGCCGTCAACGC
GATGACGTTGAACGCATGAAACTCACGCTACAGCAACTGGAAAAACATTATCAAGAACTGAACGAGAAGTCTCAAGCGAGACGTCGACTCGGTAGCAATA
ACAGCAACAGCGACCACGAGTCAATGGCTCTCGAGGCAGATTATTATGCGCTGGCCGATCTTTCCCATACATTGAAGGAGGAAAAGTTCTTCTTGGAGCA
GATATTGGTGGAAAAACAAAAGACCCACCGACGTTTCCAGCAAGTGATGGTGGATCGCCAACAGGAGCTGGAGCTGGCATGTCCGCTAACGACGGAAGAT
TCGTCCTTGTATTCGGATTATGAATATGTGCCTATGACAGAGGACCAGGCCAACGAGCATACACGCAACTGCTACCAGCAAATGCGGCTGATGGAGGAGA
CAGTGAAGCCGATTGTATCTTCCTTTGAGATCCCAGACGGGGAGGACTCGGATGCCGAGTCGCCAAGCTCACCGTCATCACCAGCCTCGCCGAAGCAGCC
GAGAGTAGAGAGAGGCTGTGCCTTTCCACCGTCCGCGACGTTCGGCTGGGAGGTTCGCCACGAAACCAACCCCGATGGAGATTTCTACGTGAGCTTTTCC
AAGTTTTTCGTCGGGATCACGGCACAGCAAGCCATGGTTAGCAGCTGGATACGGGACTATAAGCCGAAGTCAACGCCATTTCGACGCAAACTGCGCTTTG
AGGTACTCCAAGTCATCAACGATAGCACGTACATCGCAGGTACTGACATTGAACATCCTGTGGAGCACGACAAGGTCATGCGCATGATCTTCCTGAATTT
CCGCATGCAAACTGAGAAGGGCTATGTAATCGGCCGTCATTCTATAAACCCTTCCTCGCCTGAACTGCGCGCCATGGCCGAGAAAGACTCGAACTTCGAG
TACGTGGATAGCTCTAACTGGGTAGAGTTTTCAGCTGAGCACGACAAACAGACGGGCGAGTCTGGGTGCCTCGTCAAATT