Description :
From Genome Similarity Track
Location :
Scaffold_1695:537- 2128
Sequence
1591 bases(100 bases per row)
CGGAAGATGAGCAAGTCTGTTACCGTGAAGGCGGGGATCTACACGCCGAGGATCTGGGAGAAGGCATGGCGGTAATCCCGGAGGTACCACTGACCACAGA
AGAAGTCACGATTGATGATATCCAAGTGGATCCGGGGGCGAATGAACCTGCTGAAGTGGATCGTCTGCGTCAGAAAATCTGGGAGAGCCGACATCTGCTG
ATTGGTAAAGGTAATGCGTTACCGCCCGCTGCCCGCGGAGTCAAATGTGACATCGATGTCGGCGACGCGAAACCTATCGCTCAGAGGGTGCGGAAGGTGG
CACCTCAGTTCCGGGAAAAACTATCGGACCTGATTAAGGGCCTGCTGCAAGCCAAGATCATCAGTTTCTCGACGTCCCCGTGGGCATCCCCAGTGGTAAT
CATCATCAAGAAGAACGGGGTGTGTGCATTGATTACCGGCTGGTTAACGGTCTGACTCGATTGATGGTGTATCCGATGCCCCTAATCAACGAGCTGTTGG
AAGATCTGGATAAAGTACTCTGGTACTGTTCTCTAGACATGGCCAGTGATTTCTGGGTGGTTACTATGACGGATCGAGCTCGCGCAATATCCGCATTCAT
CACACCGTTTGGCCTGTTCGAGTGGAACCGGATGCCGTTCGGATTGAAGAACGCACCCCAGATCTACCAACGCCGGATCGATAACGCCCTCTATGGATTC
ACCCGAATACCGGAGTCCGAAACAGGTGGGTCTGGGGAAGGCCATACGGAAGTGGATCCATTCGAAGCGGGGGAGCCAGGGGATCCTGGGACCCCCTTCT
GTGTTAGGACGCAGATCTTACATCGACGACATTCTGATCCCGGCGGAATCGTGGGATCTGTTGTGCGAGAGAGTGACGTCCTTACTGGAGGCGTGTACTA
AGTGGAATCTCTCTATTAGTGTGGTAAAGAGCTATTGGGGGATGCGCAAGGTGGAGTACTTAGGCCATCGAGTTTCCAAGGAGTGATTGGAGGCGAATCC
TAAGGACCTGTCTTCATTAGCCGATTTGTCCTTCCCACAGTCGTTACGGGCGATGCAATCTTTCTTGGGCAGTTTGAACTACTACAGTCGGTTCATCGAG
GATTACGCCCTGTTTGCTGCGGTATTGTACGAATTGAGAGAGGTAGATTTTGCCGCGATGACCACTCCAGCTGTCCAGATGAAAATCCAAGAAGCTCTGG
CCCAGGAGATGCCGGATCCACGAAGGGATCCAAGTGGTAGGACGCCAGAAGAGGACCTGAAACAGGAGCTAGACCCACCCCGGGACCAACAGAGAGAGGA
TCCAGGCTGGATAGAGACGACGGATCAGAACATGGAACAGGCGGAATCTCGGTGGATCCGAGCTCAACACGCATTCGTGGAACTGAGGAACAGAATCGCG
ACCACGCCTATCCTCCGTCACTTCGATCCGGAACGTCAACCTACGGTAATAGTTTATGCCAGTGACTGGGCAGTCTCAGCAGCTCTGGTTCAAGAACATG
AGGGGATCTGTCATCCAGTCACCTTCGTCAGCCGGACACTGAAGCCGAATGAATTGAACTACGGAGCGGTGGAGAAAGAGATACTCGCGCT