Description :
From Genome Similarity Track
Location :
Scaffold_53:5369- 6372
Transcript NameFunction/comments
Albla_Nc14047140protein phosphatase 2C putative

Sequence
1003 bases(100 bases per row)
TGCTGGTGTCTTCGATGGACACGGTGGCTGGCAGGTCTCCAATTATCTCAACACACATCTGATTGATTATGTCCGGCAAGAACTGGGACAAAATCGTCAA
ACAGGCGATTCCACATTGGACTTGCAAGATAGCATATGTGGTAGCTTACAGAGAGCATTCATGCGAACAGATCGTGACCTGGCAGCTCGAGTGCGCTTAG
CCTTCGAACTCGGATTTGGCGCTGTTGGTCGATGTGGTTCGTGCGCCTTATTGGTCTACATTCATGAAAATCTCCTGAGCGTGGCAAACGGTGAGTCGGT
AGCATTTATACAGCTACAGACAGAGCTAATATCGCTGTAGCTGGGGACATACGTTGTGTTTTGGGTAGTCGCAAAGTGAATGGAGGAGACTCGGTTCTTA
TAGCAAAAGCCTTAAGTAATGATCACAATGCGATGTCAGCAACGGAGCAAAAGAAGCTTGTTCTCGAACATCCGGGAGAGGTGGACGCATACAAGTGTCG
GCACCCCCAATCTTGCTACGTCAAAGGTGTTTTGCAGCCTACTCGGTTAGCTACTTCGAAAGGTTACCAGCAAACATGGTTAATCTTGTATTCATTAGGG
CGTTTGGTGATTTTGCGCTCAAATATTCTGAATTCAATGGACCGCCGTATGTCAACGGAGATCGTTCAGCAGGTCGACACATTCGGTCGCCGTACACACC
GCCGTATATCAGCTCTAAACCCGAAGTAACTACGCATTTTTTGACGAAAGATGACGCTTTCGTGATCATCGGTTCCGACGGCCTTTGGGACTACACCGAA
AATGACGAAGCGGTCAGTATCGTGCAGACTATACTTATCGAAAACAAACGAGAACATGCAGCTCGTGCGCTTGTGGAGAATGTCCTACAAAAGGCCGCAA
GACGCTATGAGATTTCACTATCATCAATTTTAAAATTGCCCCCAGGTTCAGTCCGTAGACGTCACCACGATGACATTTCGGTGATAGTTTTGTTCTTTGA
TCA