Description :
From Genome Similarity Track
Location :
Scaffold_5:5368170- 5370423
Transcript NameFunction/comments
Physo_317821chimeric DNA-directed DNA polymerase bf2-7a
Physo_263055predicted protein

Sequence
2253 bases(100 bases per row)
GACTCACCTTCGCGCTGCCAGAGCGCTCCAGCTAACCGACCAGGTTGTCACGTCTGGAGACCAAGCTCGCCGCACGGTGCCCCTCGTCGGACGAACTATT
GCTGACAAGATCGATCAAATTCTCAAGCACGGGCGCATTGTCAACGACAGTCCAGTGTCGAGCGGCGTTCAACCAGCTCCGATCGTGGTGGACCTTCGAG
AGAACCCGGCAGTTCGACCTGAGAACCAGCGCATTGTTGACGCTCTGGTTGACTATGGCGACAGTCACCTTCATTCCGGCCACCGGGGCAAAGGAATAAC
CCACTTACGAGCAGCTCGAGCCATCCGCGACGCCGATGTGGTGGTGACGTGCGGTAAGGACGCGGTCGAGTCGATCAAGCAAGTTGGGGCTCGAGTTGGT
GAAACGATCGACCGGCTTTTGGAGCAGGGCAACGCTGATACTGACGAGGATGAGGATGTCAGTCAAACTGATGAAGGCAGCGAGTATGGGGCTCGAGAGC
CTTCAGACACGCCGCCGATTGTGCTCGAAGTGCGCAGCAAACCAGCTCAAGTTGAGGGGAACCAGGAGATTGTGGACGCGTTGTCTGTGCATGGAGAGAA
ACAGCTTTTGAGATGGCACACCAGTCAAGGAACGGCGTTTATGCGTGCAGCTCGTCGCCTCCGTGATGCTGCGGAATTGGTGACTACCGGAAGTGTGGCT
AAAGCTCTGGGTTGTATTGGAGATAAGGTCGTCACGTTTATCGACACTGTGGTCGTGTGCAAGACAATGGAGGAGGTCGAGGTCACGACGGGCTCGGATG
AAGGAGAACTGCAGTAGTGACAAGATGTAGCTGCCCGGGTCACACTGATATTGATTTTAGTTTGCATGTACGGACTGAGGAGTTGTAACGCATTAAAACA
GTGGAGATGCAATGGACACGAGCACTCGTTTGGTGCATTCACGGCCTTAGCTGCGTTGTAACAACTTCGCCGGACCACACACTTTGTCACACGTCACACA
TCGTGTGGTGCACATAAAACAACCGAAATGGGTACAGCAAAAATAGGTACCGGCAAAATAGGCAAAAATATATAATATACCCCGCGAAAACTTACCGGTA
ATATAAGTTCCCGCCAAAACCTTTGAACACTTTTGGCGCTCTCGCGAGTGCGCACTCGAGCGAGCGAGCAAGTTCAACATGGAGGAAGCCGACTTCGTAG
CCGACTCGGACGAGGACGAGCAGGAGCTGCTGGAGCAGGTGGCGCTCGCGGAGGAGCAGCACACGCGTGAGCGCCTCGAGGCGGCGGCTGCAGCTGCTGC
GGCGGCCAAAAGCAAAAGGGAACTCGAGCCGAAGCGAGCGCCTGCGGCGGTTGTGACGCCAGAGAAGCCGCCCACAGTTCAAGAGCAGCCGAAACAAGCC
CAAGACGAAGCTGGAGCCAAAGACGAAGAGGAGAAAGAGCACGTAGTTGAAGAGCAAGACGAGGAAGAGGAAGTGACTGACGAGGACGAGGAAGATGACG
AGGAAGAAGAAGAGCAGCTGGATGAGAACGCTATCCTTGAGGTCAGGACGGTGGTGACGGTGGACTCGCGCACGTGGCCGGGCATCAACAAGCTCGGAGG
CTCTGGTCACGTCGTCCGAGTCCACAGAGAACCTGCAGAGGACGGAGTATCCGAAAACATTTTCTACGACGTCCGCTACGTCCTGGGGGGCTTCGAGAAG
CACATCGAGAGCAAGTACGTGCACTCGTCCAAGATCTTAGAGCAGCAGTCGACCCGCAAAAGTGTGCGCAGAGATTTTTACCACGGTAAGTTGACGGAGG
TGTGCCCTTTGGTGTGGTCTGCGTCGGATACTCATTCGCCTTTTTTGAATGCGGTTCTCTTTTCTTTCTGCAGATGATTACATCAATAAGCCACACGAGA
AGAAGCAACGAGATGCAGAGAGAAAGCGCGAAATAGCGTTGGCTCACCCTGAACGATCGGAGGCTCATGCTCCGCTTCGCAAGAAGCGGAAGCGCTCTCA
CCGCGCAGAGCACGCCGAACGGGTGCCCAGTGACCCACAGGATGAAGAGTCGAATAGTGATGATGAAAGAGACACGAGGCGCAAAGTGGCCAAAATCGAC
GAAGACGCGTTCATATTCTCGGAGACGAAGGAGCCGTCGCCATCGCTCGAGGACTCTAGTCGACCACCCAGCGACAGTGAAAATTTGCCTGGGATTCAGA
GCCCCCCGCTGAGAAAGCCAAGGGGGACCCAAAGACGATGGCACCGCATACTG