Description :
From Genome Similarity Track
Location :
Scaffold_1025:5367- 10185
Transcript NameFunction/comments
Phyta_totarag11791hypothetical protein

Sequence
4818 bases(100 bases per row)
CCTCGAGCCTGTCAGCATGTTGGCGGACAGCGAGGCGACAGACTCTTTGCATAGGTCTTGAACGTGTCCGAGACCCAACGACCGTGAAACTGGATCGTGA
GGGCATCGGTACCGCAGCGATACATGTGCGTCGCACCCCCGGCGCGGAAGGAGTGCGAACTGAACTGACGCGGGTCTTTGCTGGTGTTTACGGCAGCCCT
CTTGATAGTATCGGACACGTCCGCGGTCAAGACGCAAGCAGGTACACCAAGTCGAGTCAGGAAAACTGCAGCGTGGTATGGACATGGGGAGGTCTTTTCT
AGCTTGGAGAAAAATCAGCGCACTGAACACGGGGTACAAAAAAGGGTGACCGGAActgtgacgggggtcacacgcaccgtagcggggaggaagcgttagc
ttacgaaccNCGAGAGCCGTGTggacacaccatcgctgtgtgtcctacaccgggaagtcttattctttcatccgccatttccccggcaacggcgaggcca
cgcggtggccccattacagGAACGAGCTAGCATTCTTGACGTGGGAGCACCGCCTTGGTTCGTCTTGGAACCGATCAGACGCACTCATACCGAGCGAGCC
TGAGCAGCCGCTCGTGTAGGCTGACCCGACCCGTCCAGTACCGCGATGTCTTGCGCTCTTAGCGCGAATCACTTGAACGATCCACCACTTATAGCTTCGA
TCTCTGAGCGCCTCAGGAGAAAGAAGAATGCCAGGCACGTTACCCCCCAGAGAGCTTGCTCAAAGGGTTCAGCCAGCGTCATGCCGTGGAAGCACGCTTC
CAGGAGCTTCAAAGAAACGGACGCTTTCCGGTGCCGCGGAGCGTCAAGACGGCTGATGCCCTTGAAGAGCATGCGGATGTGCGGGTGTGCAATTgggaag
ttgaagccgccCGCCGCGAAGTAATGTCGGACGCCTTGAAGTACCGCCATGATGGATTCGCTCCGGATGGGGGCTGCCAGAACCGTAGCCAAACTGGAAG
CCGTGTAAGATGAAATCAGAGATATGCTGCGTTTGAGCATCGAGTGGGACACTGATGAGCCAGGGAGAAATCCCTCGTTGCGATGCCCATGCCGTCCATT
TGGTTAGTGCTCGTCTGTACTGGGAAACGCGGCGTCGGCAGCGGAGTGTGCGCGGAGATACTCTGCCGGAGCTTGTCCAGACCCTGAATATCGATCGTAG
GAGACACACACAACCACCCGGCTGTTAGTAAATCAAACTTAGTCTCGAACGAGAGGTTAGCCGTGATGCGGGAGCCGGCGTCTGCACGAACGTTGTCTTT
CCCCGCGATGTGTGAAGCGGAAAAGCGAAGTTGTAGTGATGTCTCCCACCAGCTGAGAAGGCGGATAATCACCTGGGCGCGTGGGTTACGCGACGCCAGT
TTGTTCTGCCAAGACACGGCCGATGTATTGTCAATCCGGAAATGCACATGACGAGGCCGACCGTGGCGAGAGACATCCGCAGACCAGCGCGAGCCCCAAA
CGTAGACGGCAAACGCGCAAGAAAGTAGCTCACGAAAGTTGATGTCAAACCCATTACGGGTTCTTTccttgaactcagcgatCAGGTCGCGCTCCAGAGG
AGAGAACGGGTATGTCAGAGCCACGCACGATGTCACATCTAGCGCACATAAGCCAACGTCCGACACATCCACCGCGACCACAATATCTGGGGAGGGTAGC
TTGTTGAAGTACTCGAAAGATACACTGTTAAGTTGAGGCGtgtgcagcacgagccacCACCAGAGCAGGTCCTCCTTCATTGCAGGAGTCACAGGAACAC
TCTGGAAGCGGTGTAGTCAGCTTTCCCGTTAGCGGAGGCGCTGTAGAAATGGTCTGGCCGCACGAATGCAGGTGGCCACGTGTCTGAGGTTTCCCATGAG
CGACCGGTAGGCCTTGCGCGAAAGCGATGTAGAGAAATATGCGGACGAGACGATATCGCGGCCCTTGTCAATCTTTGCCTCCGACATAGAGACGATCCCC
GCTTCAGAGTCAAACACCAGTCCAAGCACTCGTTGCCGCGTGTCCCAACCGCTGAACTTGTCGGTGTTGACGGAATCCGCGCCCAGTACGGCGGTCATAG
CATAGCGTAGTGAGCGATCCATCTCGTCGCAGGCAGATCCGACATCCGCTGCCACATTAATGTGGTCTTCGACCCAGTGGTAGTTGAATAAGCCTGTCGT
GCTACCTGTGTTGGTATGCGAGCCGTGCACGTGAGATATCGCGCCGCCGAAGAGCTCGTAGAAGCCTGGAGATCCCGTCCACCCGAACGGCGCCGCCAAT
TCGATCACCACGgcgttttcttcttcaatcaGACCGGCAAAACAGTGCACACTTTTGCTGTGGACGCTGACGTTTCGGAACGCCGGTAAAACGTCTCCTG
CCATCACCTTGACCTTATCATGTGGGTGAGCCGCTTTCATCTTTAGCAGCTCGGTTGCGACTGCGTTACAGTGGCTGTAGTCCAGTTTCGTGATGTTGTC
TTGGTCGGTGCAGTCATTGACCGATGCGCGTTCGGGGTACGAGAGGTCGTGAATTGTGCGCCCAAAGACGCTGGCGTCTTCGTCACCCTTGTCAACCACC
CCGAAGGGGCTAATGAATATCTCCGGCCATTGCTTTAGAAGATCCATGGCAACAACCAGGCAGCGCCATGCATCTTGCTCCTTGCGAATATTTTTGCGCA
GGATGTTAATGCGGTCCAGCGCAGAGCCGTGATTAGGCGGGCGTTTCAGTTGCCTCGGTGGTGCGTTGTCaatttcacttcaacaccttcGCGCACAATC
TTCTGGAGCCGATCGAGGTGTTGATAGCCCTTGCACACCTCGTCCAGTACGGCTGGGACCAGGCTTTTGTTTGGTCGATAGTCACTCGCTGTTTGCCCAC
GCACTAACTCCACGAGCGCCGGTAGCGGAAGATCTGACCATCGTGCGAATTCCGAGAGAGATCACTGTAGAGGCGTGTTGAGCAGGAACGTTGGTCCCGA
AGTGCCTTGGTGTGACACAGGATGCGGGCTAGAAGGCAGCTGCACCCCGAACTTGGCCATGGCCTTTGCGAGTGAGGCTTTCCTCACCTGTAAACTCAGC
TGACTCCGTCGATTTGCGTTTTCTTGCATTTAAACTGCCACGTTCTGGTTCACTACTGGTCTCAAGCCACTTGGCGGCCGTGTTTCGTTGCGAGTAGTGA
TATCGTCTGCACCCAGTCCACGGCCAGCGCTTTTGTGGCCCGATTCGACACTTGTCATGGTCGCTGGTGAAGGATGTGCAGGAGCCGCCATCTATCGCAA
GCCATTCAGCTGTGGTATGTTGGTGTTCGTGGCGGGtccacacgagcagcaggtcgctTTCTTCTGCGACCGGACAAGCAACCGGGCGGCGCTGGGTGTC
GACATAAGTCGTTCGTGAGCCATGCGGTGTCGACTGTGAAGTCGCTGGATAATGCATGTTGAGGAGTGACTGTATGGTCGTCTCGAATTGCTTGGTTACT
TACGGCTGTATGGCTGTATGGCCATTTGAGACTGTATAGTCATTGCTGGCTGTATGGCCGCTCCGCAACGGCGTGTTCAAATGGCGTTGAACACGCGATT
TTGCGTGTCGTGGCGAGGTGGTGATTGGGTGTGACGCGACGTTTTCCGAACCGGAATACATATGCTCTGACGGAAAATTATCCGCTACCGCGAGCTTATA
TTTCTCTGCCGCTTCGCTCCCCACCCTATCCGCCTCCCAGCGTGATGTGCTGAGCTGCACGCTAAAGCTCGTAGACACTTCGTCCGCAGAATAGATTGTA
TTAATCTGCTTATCTTGGCCTTCATACCGAAGGGATGTCGAGCTGGTATCCTCTCGGCACCATCAGCGACGCTGGTGATCCGGGCCATTGCTGGAGCGAG
TACCGTACGTCTTGTCCACCCACTCCTGTAAGCCGGTAAGGAGCCGCTCCTTCCAGTTGTGTACACGCTGAGAGTTGCCGCATCCCTCCTCCGTGCCACC
GGAACACGGGAGCCCGGCAACGTTGCGAAGACACGGCTCTTGACCCCGGCGGTTCACGGGGATCAAATGCCGGATGGAGTCCGGAATGGCAGGCGGCCGA
GGCTGGTCACGCCTTACGCGAGGAGCTGCATCGTGACGCTCCCCCTCCTTGACTTGAGTAAGCACACCAATCAGCGCCATCGTCCACTGGGCTGACTCGT
AGTCGATTGCACGGAGCACGTCACAGTAgccacaccaccacagcGGGTTGTCGACTTGAAGATGCCCGAGCGCGGCCCCAAGGAACTTTTGTTGGCGTAC
AGCAGCGTTAGTCGGACGCGTGCCGGGGTGTTCGCGGGGTCGGCCGACTTGTTCTTGGACACAAACGTGCGGAGCCGAGAcgtcagcatcagcatgTGGT
CGTACCACAGCTCTTGGTCCATCGCGTTCAGCCCGTGGACGCCATCCAGAATGTCTTCGTACGTGCCGCACCACGTGGTCACAGCAGACAGGTTGGTGGA
CGGGCTAAAGTCGCTGGCGAAGTTCGCGTTCGAAGGCCCGTCttccagcgtcgccaacTCGCTAGACTCGCGAAAGTGAAGCAGCGTCAGGCCTCTTGAG
CCTAGGCGTCCGCTGAAGATGGCCATCAGCACGGCCAGTGTCGCTTGTATCTCCATGCACTCCAGCTCCCGCATCGACAGAACAAACGACATAGGTGAGA
CAGGCATACCTGATTCGGTGCCGAACGTCTTGAACATCCGACTTGCTGCCAGCATGTGCGCCTGCGGAGGGTTGTAGTCgcccttggccttcttcgaACC
TTCCgggaagctggagct