Description :
From Genome Similarity Track
Location :
Scaffold_5:53665- 56487
Transcript NameFunction/comments
Physo_128518hypothetical protein

Sequence
2822 bases(100 bases per row)
TTTGGAGATTCTGGACGCGAGCATCACGTTGATCTCTCCCTGGTAGCCGTCCTTGCTCATGCCCTTGTAGGTCCCCATCACTATGGCCAGCATCATGTTG
AGGAGAATAAGGCTCACGATGATCATGTAGCCCCAGTAGAACCACCCGGAGCCGCGGATGTTGTAAATGGTGCTGAACTCGAATGTCCCGAAGATCATGT
TCATGCAGGACTCGCGCGACAATGCGGCGGTGGAGAACTCGCTAACGCGGTCGCCGAACAGGAGGTTCCCCATGAAGGAGAAGGTGATGAAGATGATGAT
GAAGACGAGAAAGAAGTCGCGGAATTGACGCAGCGAATTGCCAACCGTGCGAGCGAACACGTTGAGCTGCGGGTGGAAACTCAGCTGGCGGATGGTGTAG
AGTCCGAGTTGCAGCACTGCGATAGCTCCGACGATGCTGAGTGCGTTCGTCCAGGCTTCTACCTGATCCAGGGCTTGGATGACTGCGATCGTGTCGCTCT
CCTTTTGGTCGAGCGTTTTGCCGTAGACCTCCGGAAGTCTCAGCAGCTTTTTGTCGAAATCCAACGAAATCGTCACCGTCCAGAGAGTGGCAAAGGCAGG
AAGCGCCCCAAACTTGAGGACGAATTCACCGATAAGGCGTAAAACCTGGCGGGTCTTGTTCATCTTCATACGTCGGCTTGACATCTCGCTATCATCGGGT
GTGACCTGCTCCGTCTCAGCATCATTAGAGGAATCGGCAATCAGAGGAGGTCTTGCGCTCTCCAAATACCGTAGAACTGCCCCGAAAAAAAATGTAGGCG
ATCACTACGGGGATAATCGTTGTCCAGGTACGACCTCGGTAGTCGGGTATGGCGCTTGTACTTGACTCGACAGTGATGAGTCCTGTCCGGAGGAAATTTA
TCTTCAGTCGCGTGACGGTGAACACCGCTGTACGTAACAACAGTGATAGCAAGTTGCTCGGAATGGTAGTTCACCCACGTGCCGTTCTCCCTCAAAGCGT
CAATTACACCTCTCGCCTCCTCCTCGTCCAGGTTTATCTCCAGAAACGTCGACGTCTTCCCGGAGTTGTCGACGTACGTGCACATCGGGTACAGCTGCAG
TAGAACGAATTCCGAGTCGCAAGACTTGAACTCCCTCGGCGTCATATCCAGGATAACGCCTCCAAGCACGCGGTTGGCTAAATCCAAGTGTCCACGGTGG
AAGTCTGGTAGCCCGTCCCCGGTGTGGTCGGTCGTCACGAACACCGTGGGGATGAAGGTATCGCTGAGCCAGTTGTAGACGTCGTCGACGCTGTTGATCT
CGTTGAACTGGACCGTCGTATCATGTATGGAGATGATGCTACTGTCGGGCGCTAGAGTCGTGGCCACTGTCATCGATTGAATATACATCTTCTCGTTGGG
AGTTCCCGAGTTAAGTAGCACGGCGAAGATGACGCAGAAGCCGACGGTGGTGAACAACCGAAAGAGCGCAACCCCGAGCACGTAGTAGTCGAACTCGAGC
GCAGCGATGGCGTCTTCCACGAGCATCTCCAGCTTGCTGTCGTCCGCTTCGACGGGTTTGTCCTTCAGACTCACCGCGCCGTTCGAGTCACGCTTGGGCT
TTTGGTCCATGATGGCAAGCCAACGCCGGCGTCTCGTTGCCTTCTGCAGCTCTGCATTAAGATTGCCGACGGCCGCCTCGACAATGACAGTGGCAGCGTT
GGTATTGGTAGTATTGATATCAGTCTGTTGGTCACTCGCGTCGTCTGCAATCACCACGCTGCATGTTTCCGCGGCTGGTGGTTCCTCCATTATCACCGGT
ACGCCGTCGAGCTTACTACCAGAAGAAGGAGGTCGGTTGGTGCTGTACTGCTTGTAGGACGCTTGAACACTTTCAACTAAAGTTGATAAATGATCTGCAT
CCGTCCACAGACCCATCGATCTCTCACCTAGCGGTGCCCTATCGCATTTCCATTTCAAAACGGACGGACGACATCGTTTATCTTTGTATGGCTATCATGA
GACCGTGGTAAACTAACTATAGCTGTCTCCTGTCTGGGACTGCACCTGTCAATTCTCCTAGCTGGTCTCAGTCCCATGCACGGTTCTCTGCATGGGCGAC
TAAACAATTCGATTGCCACGAATAACATCATACTGGGATTGTGCATTGACAAAAGATTGAGAGCGAAGTAACTGGGGTCTCGCATCTTCTTGGAGTCAGT
TGCTACACAATCCTGTGGCCACGACGCTATCTTGCATGAGGTTGGAAAACTAGCAGTAAGTGGACGTTTAGAAGCAGATTTTTTTTAATAAAAAGAATTA
TCCGATATGCCATGCATACGATAAGCGAGCAAGTTGACGATATGTCAGTTACTGCGGACTGCAGCTCGAAGCCCAGTTACCTCGGTGATGATACATAAGT
CGTCTTCCGGTGTAAACTGTTTGCTACCGTTGCTTCTTCCGCAAGCACCCATGCCACATCGGTTCGTGCAGCTCTTTCAAAAAATCATATTGAGCGGTAG
TTCCTCTGTGTCCAAGGAGGCGGTGAAAAAAATAGCAGCGTTGAGCATTGCTATAAAACAATGGCTTGGTTTATCTACATAGCGGGTGTCTTTGTCACTT
AAATCGATCTCACGTAATTTTACATCTTTGCCTCCACTTCGTGGTTCATACAATTGGGTCATGTGCAGGCTGAATTATCGTCCCCACCTTTGCGTTCTGG
AGAGAAAACATAATCACTGAAGTGGCGAGCAGAAAGTCGTTGGCGATACTACACCGACTTCGGCACGGATATTTATCAAGTGTGCTGGCGCTCGGATAGT
AACCCAATTGAATGTAAGAAGT