Description :
From Genome Similarity Track
Location :
Scaffold_965:5366- 10110
Transcript NameFunction/comments
Phyag_g8893hypothetical protein
Phyag_g8894hypothetical protein PHYSODRAFT_391233
Phyag_g8895acyl-[acyl-carrier-protein]-UDP-N-acetylglucosamine O-acyltransferase

Sequence
4744 bases(100 bases per row)
AAGTGGGCTAAGGTCTATCTCAAATTTGAGAAGTCCACTTGCCAGCTCGCTTTGCAAGATGCATCGGATGCTCCATCTGGATCGCCAAGTAACGGTGCAT
CGAAAGCGACATCTCCAACTAAACCGTCAATGCTGAAGCAATTTTTAATGGCGCACAAGCAAACATGGACATCTCGgcccaagaaggtggtggtttgCAA
TGCTCGGAAATGGATAGCGTTTGGCCGGAGCTTGAAGAAACCGGACCGAGGTGCATTTGGCTTCCAGGTGGAGGTCTTCGATGGTCACCGTGAAGAAGAC
CAAACCTTGACTTTCGTTACACGTTCCGATGCAACTAGGATGAAGTGGTTTGAAAAAATGCACTGCGCTGTAACTCGGACACGCACGTCGCGTAACAGCT
TCAGCGATatcgatgaagctgctaaCACGGCGCTAGTTGAATGTGTGGCGAAGAACCGTGATGGGCAGTATATGGTGGTGCCGGATGTCAACTTACTGGG
GCCGATGACATCTGCGAGTTTCTTCCTCAAATCTGAGGTACCTGAGGAAATGCCTTTTTGGGGAACATACCATGGAGAGCAGGGTATCATCAAGTACACA
TCATTATTTAAGCAGTGCTTGGATGTTGTATCAGTCGAAGAGAAAAGTATTCAAGCAATTGGGTACTCGGTGATTGTGGAGTTCGACGCTACCTTCCGGA
GGTCGGAGATTATCGCTGATTTCGATGACTCGGAGCCACCTTCAGTCAAATGTGCCTGCACCGACACGTACCTGATCAGTGGAAATCAGATCATCGGTTT
AACACGCACGATCGCCGACTCAGagaagctgttgcagctcctcAGTGATGATGAATATTGAATTTGAAATTTCCCGCGCTGAACGACTCATTCGTAATTT
CGCGTGAGCCATGCGATGATTTCTCGGTGATCGAGTTGCCCGTCACCACTGGTATCGAGCTCGCGAAATACCTCCTTGATTTGTTTGGCAGACAATGCCA
TGCCTAGATCGCCGCACAATCGTGCGAACTCGTCTTGGTCGATTTCCCCTGTGCCGTCGCGATCAATgtcctggaagaagagctcaaACTGCTCCTCGCC
CGTCTTGTCGGAGCCGTAGCGTTCTCGCAGTTCTTGGTAGATGCGACTAAGGAAGGCTGGTGGTTCCCAGGAGGACTCTCCCGTCACGCTGTTCCAGTAG
TACTGCGCCATGGCAAAACATTGGTCAGCGAGATGTTCGGGATGAATCGAGGGCGCATCGGAGATAGCTTACCGTGTTGCCGTTGCCATCATCATAGGGC
TTCCAGGCATCTGCTGCGTTGTTGTTTGAGGTGTCAATATTTGCTTCAGCGTAGTGGCTATCAGTGGAAGTGCCAAGAAACTTGGGTTTTTCCCAGGTCG
CTTCTACCGTACGCGCATGGACGTAATACGTGTATCTGGTAGCAGGGTCGATCTTCATTTCGACAAGCGAATGGAGGAAGGTGCGGAATTTGGCCCGTTC
AATTCGCGCTCGATAAAtgcgctgcaacttgatggcagctgcagcgcgttctGGTCCCGTGGCGTTACTCGCAGTACACGTGATCTGTTCGCGGCCTACT
TGATGGTTGGCACTTTCGTGCAGCATTTTGAGGGTGGAGTGCACCATGTACATTTCAGTATCGGTCATGTCGGCCGTCCAGTGGGTCAAATTGCTTGTGC
GCTCGTCGCCCGTGCAAAATCTCACCGTGGATATTGCTGTCCCGGAAGGTTTACCTGTTGCAGTTTTCACTCTTGTAATTTGAAACGAGTGTGCGATGTT
GTGCGGAAGCGCGTTTTGAACCTTGGTGCCATCCACATAACAGTACTTCAGATGGGGCATGGAGTATATATCTTGAGGTAGCATCCCACTCAAGTTCGTG
TTGTTTCGCAGTTTCAACGTTGTGAGGAAGCGGAGCTGTGTGATTTCAGCGGGAAATTTCCCTGTGAGTCCGTTCTCGGACAGGTCGATGGCCACAACAT
GGTTGCGCTCCCACTTCACGCCGTACACAGAGGTGAAGAATGACTGCATCGTGGTTGTCTTAGGAATTGGCACTCCTCCGTTCTTAAGAGCTGTGGCGAC
AGCCAAGACTTTGTCCCACCCGGCTTGTCGAGTCCACGTTGTAGCAACTGCCCCATCGCTTTCAGGGCGACCTCCTGTTCCTTGATAAAATGACGCCAAT
GCCAAAATTTCGAGCTGACTGTGGGACAAAGGGTGAACTGCACCAGTGCTTTTGTTGTGGCGAGTATTATCGTCCGACTCGGACCCACGAGGCATTCGAG
AACGACTGAACGCGTGAAAGTGTTGTGCGATGGAAATGCGCTTTCCTCGCTTCCGACTGCAGTTAGAGCTCCACTACCTCAAAGTCGTTTAAAATAGAGT
GTATTTTCAGTGCCACCACTTCTCTCACAACTGACTGCTTCGGTGTTAGCACTGGCCTACACTGCAACAGAAGCTCGATCTTTGCTAGCCTCCGTTTCCA
GGGACAACTGCAAAAACATGAATGTTAGCAACATCGTGGACACTTGATGAGACACATGTCTGCTTACTTTCGCCTGTAAACGTTTGTGGCGCCGTTCCAA
GGctcgttgaaggcgttgagCATGGTCACCGCTGAGAGCTTCTTTCTGGTTGCCTCCTCGGAAGGCGCCAATGGCAAGTTGCTGAAGGTTTAGTGCAGTA
TTCGCTGCATTGTTAGCAGCGGACTCGTCGATGTGTGCAGCATCTTTGTCGTCTCTATACGAGCAGAGTACTACAATGGGGTTGTTTCCGCCTACACAAA
GAAACAATGGAGAGATCAGACATGTCACCCATGGTAGAAGTATGCTCCTCACCATAAGAGCAGAGTGCAGCCATATGAGCTGTAGGCGACCAGCTCACAT
CCAGCACAGGACAGCCGTGAAAGAAGTGCGTCCCCCACACACcgcgttgcagctgctgaccGTGAAGACTGGTAAAGAGTCGAGGAACTCCATCTTCGGA
TCCACTGATAACAAGCTTGCCATCGGGGCTGAACGTGCTTTTTACGAGCAAGGATTCGCAGCTCACACCGGCATAACTTTTGTTCAGTAGAAGATAAGAC
CGAAGCTCGTACTGGAAAATTGCGTTTGGCTGTGTGTGAACCAGCAAATGGCCTTTGCGAGGATGCAGCTGAAGCGAAGTGATACAAGTTTGGCCTGTGT
GAATCATTTTGATCCTTTCATAGTCACTCAGCGTCGACGCACTCTGTGTACGTCTCCAGACCGTGATGCCACCGTTTGCATCACCGCAAAAAACTCGTCC
TGACTTGGTCTCCACACAAATGGTGTGCACCGCAGTAGCACTAACTTGTAGCGTTCCTACTTCAGATTGGACATTTGGGACTGCCGACACTTTCCGGAAG
CGTATGCAGCCGTCAGAAGCACCCGTGAGTACGATTTCTCCGTCGCTTCCGGGGAGAAATACTGCGCAATACACGAAGCAAGGAAAGTGATGCCACTGGA
ACACCAACGAAAGCAAACGGCTATGACGCGAGGCGGAGACCCGTGGGGAATCCGAATTGGAGGGAAGTTCCCAAAGGCGGACAGTGCCATCCGACGATGC
TGAGAGGAGTCGATACTGTCCGGTTGACTTGATTGTCCAGTTTAACGAGTAGATCACCCCTCGATGACCTCGCCCCAGAGCGAAGAGCTCTGCCGATGCC
ATTTGATATACTTGAACCACAAATTCCCCCAATTCTGGACTCACACTTGCGGCTAGATATCGTCCGCAAGGACTAAAACTTATAGCCGAACAACCTTTCT
TGCCAGTAGGAAGTGAACAAAGCACTCGCTGAGGAATTAGGCACGACTCGGACACATTTCTCTTACAAGGCGCTATCAGGTCGAAAATATCACTTGATTC
AATGACAGGAGGGGCATTGTTATCTCCTGTCTCTTCGACAACGGGTTCTGTAGAGACTTCTGCTGGCGGTTCTTGATTATCTCCAGCTTCGATCGTTTGA
TAATTAGCAGCGGTATTTCCATCCTGGTCAGAAGTTATACCAACATTGGCACTAGCAGCCGTCCCACTCGCTTCAGGGGTACTGGCTTGTTGCGGCGATG
TGGCTGGACTCACAGCTCGTAGCTGAACGTGCAACGTACTTGGTGCCGGAACGCGAGATCGCTTCTGGTATTGCAAGAACACCGCCGGCACCGTAGGGTG
GTTTTTCCTCCATCCCCATTGCGATTTCGCTTGGTAGGTATCCATCCAGGTTAGCACCTGGTACTCGAACAACCGTACACGCAAACCACAAACGTCGACG
ATGTTCAGTTTGTTTGGAGTCATCTTTTCATCCGGTAAGCGTGGAAGCACAAAGGAATCCATGGTGGGGGTGCCCTTGCTGGTAATTGTGTGGAAGAACC
CCCAGGCGATCCGTCGATAGTCTGGTGTAGAGGGCGCTTTGTGAGTTTTGATGTaatcgtcttcgtcgtcatcatggGTACTGACAGGCTCAAAGCTTTT
TCGTCTTAGAAAGCGGGATCTTTTTCTCGGAGCTTTAGTCTCCAATATTTCAAATAGCAACGCCGTTCGAGTGCTTAGAAAGGTGAGCATATCCATCGAA
ATGTCCAGCGGTTGTTGCCATTCAAACGCGTCTACAGCACACAACACAACGGAATAAAAACATAAGCACGAGCAACATTGTATCAGGGCACAAACCAGCA
CAAAACTTACTAGTGCAAGACGCGTTGTTGTCAGATCCGTTGGA