Description :
From Genome Similarity Track
Location :
scaffold_86:5366- 20344
Transcript NameFunction/comments
g3130.t1hypothetical protein

Sequence
14978 bases(100 bases per row)
GATGCTGCAGGAAAGTTTAGGGGGAGGCGAATCTGCTGCTAGTGCCAGGAGAGCCCTCATCCAAGTGCAGAAGCTGTTGCAGCTTGCGTCTGTCAGGCCC
AATGCGCTGACCCTACGTGAATATCGCGAAGGGCTGGAGGTAACAGGACGTTCCCTATAACTTTTACAAGTACGCAAAATAACTTTATGCTATTTCGCAT
CCTGCAGGAGTGTTTGAAGTCCGAGGGAAGCACTACAATGAAAGTACTAGGGTTCCAACTCGCTGCAATTGCTCCTGGCTGCTGCACGTACGAAACCTGG
AAGTTTGTTCTGGAAGCGGTAGTGACGGAGCTTGGTAGTTCGGAGAATCTCTCGGCTTTGGCCGCTGCGGTTCCCGTGCTCGGGCAAGTTCCAATACCGC
TTCTACTTGGCTTTCTGTTGTCTCCTGAAAGAGAGCCCATGAACAAGCTGCGTACACTTTTGACTCACGAAGACATCGAGGTTCGTTGTAGCGCCATTGA
GACGCTATCAAAGTTAACGGTAGATGTGGCTGTTAACGTCGCTGGAGACGGACTGTTTGTCTTCCCGTTCGAGTCGCACGAGGCTCGAATTTGCTGTCAA
CAAGACTTGGAGACGATGGTGAACGACTGTTGGAAGTTGATTTTCCACACTCTTTCGTTTGATGGACAGTCTCAAAGCGCTGCGTGGGTTGCGGGTACTG
CGTTCACGGCTTTTGCAACTCTGTTTGCACGTTCCAGCACGTTCTCGCAGTTTTTCCCGAGCATTCAAGACACTAGCCGCGTTCAAACGCCCATAGATGA
CGTCACATCCATGATCTACAAGCAAGTATCCCCGAGAGTTCGAGTGCTGGTTACTACAGCTCGTAGTCTTCCCATGAAGCAACAGCCAGACGCTTTACTG
TGGATCTCGATGCTTCTTTACACCATGATGGAGCACAGTGGGGCACGATGTCCAAGTGTAAGTCGTCCGTACGTGGAAATTGATACCGAAGACAACAATG
CTGATAGTATGGACGATGACGAGCCCCAAGCTTCCACGGAGCCCGTTCGAGTGGATGAATTGGTGAATGATCTACTCGAGTCCTGGGCATTTCCGACAGT
ATCACGACGGGTTTCGCTAGGCCAGGCTACTAGTATGTGCCGTGCCATCTTCATTCTGCTGGCACACCCACTTCAGACGTTCACTCGTATGCGCTGGGCT
GCTCAGCTCACCAACCATCTGATCGCCCAGTGCTATCTCGCCAACAAGCGCTCCAATCCTGAGCTGAAGTTCGAGCTTAGTGTGATGCTCGTGAAGACGT
TTGCTTGGTTGTCTGGAGTCAATTGCCAGTCACTCTTCGTTCGGACAACGGAAGCTCTTTATCTGCTCGACCAAGAAAAAGATCGACGGGATCTGGTAAA
GAACCTGATGGATACCATCGCCAAGCACGTTATCGCAAGCCGAGACTTTCAGCTACTCCAGGGTTTATGCACAATGGCGTTCTTCAGACAACCAAAGGGG
TTTTCTAGGTTGTCCCCACGCACGAACGGCTCTGAAGTAGTCCGAGCTCTTTTCCAAGCTCTCGCCAATATGACAGTACGTCGAGGAGCTGTCGAACAGC
AAATCTCCCAGCTTATTGCCTTGAGAGTTTTCAGGGGACTACTTCTCCTGAAGTTGGGTGGGTCAGCTACTACTTCACCGAAGGCGTACCGTCGGTCCTG
CGAGATGAGCGAGAACATTGTTTACTACACGGGGCTGCTGACGTCTCATTTCCAGGGGATGCTGGCTTGCCCCAACCTTGCTCTTCGTGAATCACTCGAC
TTTTTCCAGCAAGAACTGTTTCCAACAATGGACCAAATTGCGTCGCAGTGCGCTCGTCTACAAATACTTTGGATTGGTGTGCAGCTTCATCGCAATTATG
CCACACACGTATCTTTTGACTCTCTGGTACGAGAGCTTCAGCGCGAAACCGGTCGGCTTTTTACTGCAATCTGGAATGATGAAGACGAGGTGGAAGGCGC
AACTTTCGACAACGGTTTGCTTGGCAACGGGGGAACTGGTGCAGAGGAAACTCCTGCGAGCCGAAAACGTGCTGGTGACGTCAATAACGTCGACGCTTTG
ATGGTTCTTGGTGACTGTATCACGCTGTTAGCACGACTTCAGCCTCAAACGCAATTGAAATTTCTCCAGATGTGTGAGAAAATGGGTGCTGCTTTATCAG
CTTCCGGAGGCTCCCCTGCAACAACATCCCAGCAGTATCGTGTGTGCGTTTAATATGATGTCATCTTTACTTGCCAGCTGCAAACTAACCTTTTGTGTCT
GAGCAGTATTGAAGATGTTATGGCACTCCTATCAACCCCTGTACCAGCAGATTCTCCAGCAAAACTTGATTCTCCATTATCAAAAGAAATATTCGACCCA
GAGGATATTTTTCTGCCGCGAAAAGATTTTGATACAAGCAGCAAAGAAGAAAACCCGCACGACGAAGAATTTCAGGAGTCAATCACTGTAACAGGAAGCG
CTGATCCTGTATCTATCCGGGTCTCCCACCACCACCCGATGTCTGGAAAGGAAGAGATTGTTGAACTTGACATCAGCTGCTGCAACCTCACTACTTGGGC
GTTGAACGACTTAGAAATCCACCTTCGTCCGCTTGGAGGTGTCGGTGTGGTTCAGTGCGTGGACGCTTCTAAGGACTTGAAGTTACGTCTGCTACGTGCT
GGTGAGACTGTCAGCGTCGGCACAAGCGGAGGCTGCACTAGTTTACCACCATTTGGCGTGATCAAAGCCCACAAACAGTTCCGCGTTTGCAAGTTCACTC
AGGCTACAATTTTGGTGCAAGCAGTGCTCGTTCAGGATCCTATTCAAGACAGCGATGACATGAGCGGTAATCCAGCAGAGGAGTCTTCTCCAACTCCGAT
CCGACTAGCATTCAGCAATCAATACGTGCTCCATTTCGACACTCTCCTTCGACTCCCACAGCCTCAGTTTGCGACGGCCTCATTCTTCCAGCACTTATGG
CAAAGGTATAGTTGTGTACCCTAGATGTTGGTACCATCTCGTCTGTACTAAACCAAATCCTTGCTCTAGCGCTGCCTCGAGTGCAGTGTGGCGTGTCAAG
TCGCAGAGTTCACCTGGTGATAAACTTGGCGTTTATCAGCACGCGCTCCACGTTATGAACTCAAAGCTGGTGGCTGTGGCCGAACTGCTCCTCGAGCTTC
CAATGCACTTCCACGTACGTCCCTCCTGTTGATAGGCTTTGAAATTGGTACGATAGTGTTTCTCATCCACATTATTTGTAGATCGCAATGCTCTCTCAGA
CGCGATGGGGGTCCTATGTGGTCGCAACGCTGACAATGAGCCTCGAGTCGGATTCAAGCTGGTCGGGTGTTCTGGAAGTCCGGTCATCTGTCGATAATAT
CCGCGAGTTCGAGAAGTGGCCAAAAGATACCGTTCATCTCTTTTGTGGAGACCACGTGCAGCTCTGCAGTGCCCAAGCGCCCCCATTGAGCAGCAGACAA
ACGTCAACTTCTATTGACGCTTCTACACCCCAGCCAACGCTATCTCCATTCGATATCCCTTCTCCTATGCAGTCTATTGCGACCGAGAACGAATTCTCAG
CTGGAATGGCTCAGGATCTGCCCGCGGCCGCAGCGATGTTCGCACCCGATGTGCGAGCCACCACAAGCTTCCACAAAGACGTGAGCATTCCCACCGACCG
CATGTCCTCCTTCGCACGCAACAGCCAGCAGCCAGAGCAAACGCGCGCCCCCGAGGCTACTCCGTCTCCTGATGAGCAGTGGGGCAACTTTCTCTAAGAT
ACTTCTGAAGCAAGTTGAAGGCAACTTCAACTCGGTGCTTTCATTGGCTAAAATCCCGTTAAATCACTTTTCTTGCATCAGATCTACATAAGATGCCGCT
CGACCGGCATCGTGCAGCCCCGGGCGCCGCTTTTGGCAGCGAAGACGCTGAGGAAGAGCGCGTTTACCGCCCGCTGCTGTTCCAGTCCACGGGTTATGCG
TCGTCGGAGCTCTTCCGAGACTCGTACGAGATGCATTCGCGGCTGCCGACGGTGTCCTCAACCGCGCCTCTATTAGGGGTAGAAACTACTTCCACCGACT
CATCAGAGAATCAGAAACAGAGACATGTATTCGAGCCACAGATTCGACTTGAAACGCTGTCATCAAGAGCTGCTACAGCGGTGCTATGGATCACGTACAT
GGCGTTTTTGCTGGCCATGGCGCTGCCGTATCTACAGAGTAAAGGATATCTGGAAACGGTGCGGAAATGTTTTACTTGAAGTTGCCTGATCCCGATTCTA
AAACTATTCAAACTGTAGGCAGTGGAGTTGTCGGGGGCAGTTTGTAGGGACGAACAGAGGAGGGAGCCGTGCATTAAAGTGGACACGACGAGGGGCATTG
CTCAGTGGGCAGCGTATGTGGGCAACGTATCACGCTATACAGGGTCAATTGAGATCAAGCTTGACGTTCGGGAGCAGGTGAACATGTCGACGTTATCAGA
TTTACTGTCGTCACTGAAGGAGAGCAATACGTTCCAGGAGCTCGAACGCGTAGGAACTGCGTGGAATATGAATCGCGATGTAACCAGAGTGATGAGCAGC
TTAACGAGTCAAGCTTCAAGTATCTCCGAGCTTGAGGATGGAGAAGTTGACCAGGATGCAGGCTATGTGCTGACGTTCGATGCCAGACTTTATGGTATCG
ACCATGACGTCACGCCAGTCACAAAGGATCTCGTTGTGGATGAACACAATCAGAGTATTTGGGTGGAGTGCCGATCAGGAGGACCGTGTGAAGTTGTGAG
GTTACTGGAAATTTCGCAAGACGTCGACCTACTGGTAAGAATAGAGGGTATGAGTGTATTTATTGGCTTGACTAATTTACGACGCATTATCTGGTGCAGG
GAGGGAGTGAATACGATGCATATTTTGCTGTGGTGACATTTAAAGGACTGTATCCGAATGTGTTTGGCAAAGAGGTCGCCTATCAGTTCGCGTACACGTA
CGTAGTGTTCATTCGTGCATGTGCTGGTGAAAAAACTAACCTGACTTCTTGCGTGATGGTGCATCCTCAGAAAACCTGCCATCCACGTGGGTGAAGTTGT
TGTTCGTGGTGTATTTGTGCTGACGTCCATTTTGGCACTTCCTTCCTGGTTCATTTCGGTGTTAAATTTCCACTCTGGATCGTGGAGTAAAGTGTTGACG
GTACAAAAGTGGTTGTTGGGGGTGGGTGTCGTGCTTTTGCTGTGGCAAAACCCAGTATACGCAGTATCTGAGCTGTACACCACTGTGAGCTTGCGCACTC
GGTTTGTATCCATCACGTGCCAGTCATTCGCGGAGGCTTTCTTTTATGTGTTTTGGTTGAGTCTGATGGACCAGCACAGTGGAGATTTTTCCTCTCGGAG
ATGTTCCTTTGCTACAAAATTCATTTTTGGGCTGATACTTTTTGCAGTGGACATCAGTATGACTGTGCTGCGGATGCCGAAGTTATTTTTCGGGCTGGAA
GGGATATCAACTGCTCACGATTTTCACCATGAAGAAATTTATGTACTTCTCGGATTTATTCGTACGGGACTGGTGCTCTTTTGGCTCGTGTGGATAATGA
CGGTTGGAGCTCGATCGGGTCGGCATCTCAAGGCATTGCCATACATGGCTACTCGCTTCAAGCAGCTGTCGTATCGATTCCTCGTACTCGAGACGCTTCT
CATTTTCGTCTACGTGCTCGTGCTGTCAGTTCTCCAGATATTTTATCTGACCCGAACGTGGTACTTCGTAGGCTACGACGCATTTATACAAGACTCGGTG
CACACTTTTGCCAAGATGCACACTGGCCACCCATCATTAGGCAAGTTCCTGTTCCTGTCGGTGTATGTCTATTTGGTCATGTTCGTGCACTTGCCTCCAC
TCGCGGGTGACAGTACTGGCTTATTGGCTTCCACAGCTTTTCACGTGGACGAGAAACCACGAGTGGATTCTTACGGCTTCCTTACGCCGGATTCCAACTT
GTTTTGTGTGGAAACGGCGGGATGGCTACTGGAGTTGGCGTATCAAGCCTATTTCGACCCCGCTGGATGCCCGTCAGCATCTGGATACGGCGAACTCACG
CTTGAGCGATATGGCTTCGAGCTGATCACACATTTGCGAAGTAATCTAACGGATACACACGCAGTCGTCGCGTGGAGTCAAGAAGACCACCAACGCTTGG
TCATATCATTTAGAGGCACAACAAGCAAGGAAAACTGGAAGAGCAACCTTCGCGCCGATCAAAAAGTGTTGTGGATAAAGTCTCGAGGGCTGCGCTGGAG
AAAAACCTGCCTGGAAAAAATAAAGGATGTGGCAGCAAAGGTCCCCTTGCTTAACATGGCGCTGCCGCGGGTGCACCGAGGTATACGTGACTCTTCTATT
GTCTTGTTTTGTGTAAGGAAGGTGGTTCTAACTTGTTGGTTGATTTGCAGGATTTTGGATTGCTTACGAGTCGATCCGCGATGAACTGAAAGAAGTGACC
CGCCTCATTTTGGATGAAAATCCTGGCGTGTCGGTGTATGTCACCGGTCACAGCATGGGAGGCGCGCTTGCAATCATCGCTGCGTATGACCTCGCAGTAA
ATTTCAGCATCAAAGTCAACATGTACAACTTCGGAGGGCCTCGTGTTGGCAACCCAAGCTTCCGCCAGCACTACGACAGCTGTGTTCCCACGAGCTACCG
AGTTGTCATGGATGGAGACATCGTGCCGGGATGGCCGAAATTTGTACGCATACATGGATTGTAGTTGAATTCTGGGAATGATTTACCTAACTCTGCTATT
TATTATGGTTTTAGTGGGGACTATACCAGCACGTAGGGACAGAGATCTCTCTCGATGTGGCAGGTAACGTGATCGTTGATCCAAGTTTCGTCGAGCGGCA
CCTCCACAACTCATCGAGACGCAAGACGACGATGCATGGCACAAACGTATATCGAGTGTCGATTGCCAAGTGTCTCGAAAATCTAACAACTTCGTAGCAG
CACCTAATCTACATGTATCTATTGCACCATTCACCCTGTGATGCCTGCTGGGAAGCGTCGCAATCCGTTTCGCGTTGCTGTTGGCCTGACCTCTTTCATT
GTTTAGATAGTTCGGCGCTGCTCAAGCATCTAAGCGTTATGGATGGAGACGATCAGCAGGCACAAGAAGGGGTGATCCGCTCGCACATTGACCTTGCGGA
GGCAGCGGCCAACGGTTCTCGAGCGATGGCAAGTCAACATTTTCTGCACTACAGACAATGGGTTAACGAGTGTTACGTGTCCCCCAGGTCGAATTTCTGC
TGGACAACGGCGTGCACATTGATACACCTGGAAAAGGTTGCTCCTGTAACAAAATTCAGGATAGAAAAAAATATTTATGCCGGTAACACTCATTTTGTTG
TGTGAATCACTTGCTAGATGGAACGACGCCGCTATGTGCTGCAGCGTTATGGGGAAATGACGCCATGGTCACGTACTTGCTGGACAAGGGAGCCGATGTG
TCGGCTAGAAATGAAGGTATGGCAGCGTACCACTTGAGAATCCAACTAGCCTAACCATTAGAAATATTTTAGGCACAGGGTGGACAGCGCTGCATGCAGC
TTCATTTCAAGAGCACGGAAAGGTTGTGCGCGTCCTGCTGTCTCATCAAGCTGACCCTAAAATGGTTGACGTCGAAGGGCGAAGAGCAGTGGACTACGCC
AGTATTTCGGAAGCAATTTGGTCCTTCTTCTCAGGTATTCGTCGGGGCGCCGTCGGGCCTATCAAACAACTGATATCATGTTTTGCTTCAATTCAACAGC
GCAAGGCTGTACCAAAAGCCTAAAGTCCGACCTAATTGCCAAAGGAATCATCCGCAAAATCCCAGACCAGCCGGAACAGACGAACGATAAATACGACAGC
GTACGTCCAGTAAGCAGCATTTTAGTCGTATTGAGGCTCTAATCTTTTGTTTCTGCAGATCTCGTCCTTCTCGCGTCCTGGATCGGCCTATACGAGAGCG
CAAATGTATCCACCGCTCGCTCGCCGACAAAGTCCCGCCATTAAGGTGCACTATCCCAACTTCACTAAGTTATTTGTAAACTAACACTACCACCTGCTTC
CAGTCCCGCGATGGTCGCATCCTGACGGGGCCCATTGACCCACTAGGTGACATACCAGCCGAGCCTGAGTCCAACCAGCGAAGTCCGTCCCTCAAGAGAA
TGGGCATCTAAATAGGCAAAATCAAGTTGCCGTTGTTGAAGTGGCCTGAAGTAACAGATTTCTTTTCGACCAATGAAAAACAGTCAACGCATAAAAAAGA
GCGGCTATTTTGCAATTATGATGTATTCCGTTTGCCAGGTGCGCTATAGAAAAGTAGCCCTTGCGCCGATGGCCGCTCGTTTGAGAGCCCCCCTCGGCTG
CTCAGTTCTTGTATCGCTTCGCCGCCAGCACGTCATTCTACAATGGTGAGGGCTTGCACCGCCGAAGCGCCACAGTTCTCAGTCTACAGACAGCTAACCT
GACTATTGCTATCGTATGTACCGTTCGTAGTCGCTTCTTAACAAGGGATCGCGTCTTATGACCCAGTCGCTCCGCGCTGGTGCCCGCAACATGTCGAGCG
CCACCGAGCAGGAGGCCAAGGAGCAGATGCACCGATGGACCACAATCTCGAAGGGCATGATCGGCCTGGTGGCGGTGTACACTGTGTACGCTATCAGCGA
CCACTTGAGCCACGAGCACCACGACGAGGAGAAGCCTGCCTACCCGTACCTCAAGATGCGCACCAAGCCCTTCCCGTGGCCGGAGTCGGACTGCGACCTC
CTGGACACGGAGTGCCGTCGCAAGGCTCGCGAGGCCAAGAAGGCTCTGGAGTAATCTGCACGATATCAGTCTCAAGGTGGACCCAGAGCAAACTTTTAGA
CCAGACGCAGGAGAAAGGGGTGGGCTGACCTGTCAACTTCCGTCCTGTTCTTCTGTCTGTCGAAGCTACTGTCGGCTCGCGTCGTTTTAATTCTCCGGCT
GGTGTCATTTCCTGTTCGCTCGGAACTCTAAATACTTCGAAGTACTCCGCACAACACAACCTGAAAAAAAAGAAAATAAAAAACACGAAACGGAGTCTTC
GCGTTGTTATTAACTACCCTTTTCGATGTGTATTACTGGAAGCGTTGGCGTATCATGTACTTCGGATAGCAATGACAATAACATGTGCATGCAGCCGTGT
CGGTGGTGCTGCCCTCGCCCATGTTCCAGCACCGCCAATACTGAGTCCAGCATTTATACCGCGAAGTAACAATATCAAGCTGGACCACCCGTAAAACTAC
CGTTACTTTACATATAATCTTAAGTAACAACGAACAAAATGACCGACTCCATCGTAAAGCGCAGCGCCGACCAGCGCCAAGCTCAACCTGGCGAGCCCAC
CTGCACCGTCAGCCACATACAATGCTAGATGCTCTACAAATACAATAGTCCTAACGCAATGTGTCATTCTTCCTGCAGGTGTGCGGGCGATACGGCGAAT
TCGTATGCGACGCCACCAATGAAGACGTCTGCAGTCTCGAGTGCCGCGATATCTGCGTGTCCAGACAGCAGCTGAATCTCCAATCGAACCGGCAACTGGA
TGGACGAGCTGACGAGTTACGATACAAGTTAGGCATCAACATCTCAATTAAATCACCCTCTGAGACTGCAGCCAGGAACTTTTCAGCAACTCGATGGCCG
ATTCCAATTGTGGAATTTGATCAGGATCAAGAAGGCGTGGAGTTACCAAAGGAATTGCTGAGTAATCTTAACGCCAACGGGTTTGAGAGACCGACGCCCG
TGCAGATGCAGACGATCCCATGTGTGCTAGAGGGGCACAATGTACGTGGATTACGAACTGGTTAGCCTAGATTTACACAAAAAAGCTGACTTTATATCGA
TAAGATGTTGGTGAGTGCACTTACAGGGTCGGGAAAGACGGCGTCGTATTTGATTCCAGTGATCACGCAGTCTTTGCTTGCTCGGGAGAAGAAAGAGGAG
ATTCTGGCGCTGGTGTTGGCTCCTGTTCGAGAGTTGGCGATTCAGATCGAAACGGTGGCAAAGGCGTTGATGAAAGGAATTGCTGATATGAAGACAGCAC
TGTTAGTTGGGGGATTCCCTGTCCCTACGCAACGCTACCGTCTTCAAAATGGGGTGCAGCTGATTGTAGCTACACCAGGTCGCTTTCTTGATATTTTTAC
GAACTACAGTGGTGGAGATTCCATTCTGCCGGGTATTCGTACCTGTGTGGTTGACGAAGTGGACACCATGCTAGGCGTTGGGTTCCGACCACAAATCTCT
CAAATTGTGGCTTTGCTGGGTGGAGAACGCACCAAAAATGTTCAGCTGGTGTTCTTAAGCGCTACAGTGTCACATGAAGTGGAAACCCTGGTGCAGCAGC
TATTGAAGTCCAGAAAGGAGCAAACGTATGTTCGCGTTGATGTTCGGGCCGATAAAAGCAAAACAGGCGAGAACTTTGTGCTAAATCCAAGTGTGAGACA
TCATGTTCGGTGGTCAGCAGACAAGGCAAAGAAGAACGAGTTATTCGAGTTCTTGAAGGGGAAAAGTGAAGAATCAACGGTAGGTCTATCTTCTCTATAT
TGAATTACTTATCGATCTAACTCAGTTTCTGCAGCTTGTCTTCGTCGGGTCAAAAGTTGGTGCAACGCTGCTGGCACAAGCGATCGAGAAGCGCTGTGGG
ATCGGCGCAGCTGCAATTCATGCGGATAAAACTCAGCAGGAGCGACTGCGTTTGCTGGAATCATTTGTCAACTTGGAGATCCCGGTCCTTGTGTCTACGA
ACGTGCTGAGTCGTGGTATGGATCTACTGAACGTTGAAAACGTGGTGGTCTATGATTTCCCAAAGAAGGTTGCAGACTATGTTCACCTCATTGGCCGTGT
CGGACGAGGTGTAGATGTGCTTGGAAACGCTCTTACACTTGTGAATCTGGGAGACCGTCCACTTTTCCGAGAACTTGTGCCACTGTTGCGCCTAGCAAAA
GTGTCGGTGCCACGTGAAGTACACCAGAATATCCACTCAGAAGACACCAAAACGCGTGCTCGACCCAGTGATAAGGTGGTGGTTGATGAGTGCAAGCGGG
ATTTTCGATTTCGGGAGAAACTGGTGGAAGAAAGGAGCTTACAAACATCGGACTGGAAGGAATGGGAACGCCACAATAACAAACGGAGACGAACTCAACC
GTAATCCGCTTACAAGTTCTTGGGTGTTCCACTGTCAAGCATTAGTGCGGAAAATATGGGCCCACGTTTTCTTCTATGCACTGCAGGGGCAACTCGATCT
CGTGATTTATTTGTCTTCACGACAGCTCGCGAGTATTGCCGTTTTCCTTTCGAGATGTAGTTATTGTAGCACACAGCACCCCGAATAATGGCGACCTCCG
TCTTTGACACCATTGTGAAGCGCCAAATGAGACGAGGGCACCACAGTGCCAGCGTCACGACCCGACTGAAGTAAAAAGGCATGATACGAACGACTACTGG
GTGGCTCCAAATAACTCCTTGGAATATGACGGTATCCTGCAGAGCTTCATCTCCGATGAAAAAGATGCGACTCATAATTACGATGTGAGCTAGAAGCAAT
AGAGCGACCACGGGGGCTGCAAACTGGACTCGAAAGCGTAATTTATCTTTGATGACGGGTGTGAGAGCATCAAGTGAAAGAGACCAGAGAAACCAGATCT
CCCAAGTGGCCACCATAATGCAGTGAGATGTCTCCCATCCGCTCAAAACGCACACACTCAGATTGGCTGCGGTAATCTGGAAGGCGTAAAATAAAAAGTC
GAACGACGTGACAAGAAGCCTAAGGAGCTGGCGCTGATAAAGAGCGACGAATAAAGCAACGAAGATCAAAGTCCACAGAAGTGCACTCCACGCTTCGAAG
ATCAAGACAGCCCCACTCAAGCTGCCTAGAAAAACGGAGCACGAGAGGAGGAAACCCACAGCACCAGCAGCGTAAAGTGGAAGCAGATACCAGGCTGAAT
AGGCGCCGTTGGGGATTTGTTGGGGGAAAACTACGTGGCTGGCGTTGAACACGTGCGGAGACTTGACGAAGCGCATCTTTTGGATGATGTTCGTCTCACG
CAGCATCACTTTCTTCCTGTTTGCGCCAACTCCACGACGACGAACATTTGCCCGGCTAACGTGATTTTTGGTGGAGTTTGCGTGTTGAATTGGCACCAGC
TGCAGAGAGCATCGGTAAATTACACAGTGAAGAGCTGATCCCTGGTTCTTCTGCAACGCTCTTCGTTTCCTCACTGCAATTTTTGTGATGAAAAGTGCGA
GCGTCAACAATCCATTGCCGATTATATCGACGCCAGAGAGATGGAAACTGCGGTGCTCATTCTCGTAGTCCAAGAGCGAAAAGCTGGTACAAGCATCGAC
ATGACCCAACATGATCCACACAAGCATGAAGAGCACCGGCGGAATTCCGACAATAGTCATGAGCGCAAATTGACGAACTCCTCGCACATGAGCGTCGATG
CAAACGATATGATGGAACCCCACCCAGTCGATAACCATTCGAAGGAACCGCAGATCTCTGAAATACGCTGAGACCATCCCAGCGGTCATACTTGTGACGA
AGGAGAAGAACCAAAAGTCGAATGTTCCCATGAGAAGCAACACAACGTCATACCTTAAAGTACTGAAAGCTCCCAAGCCAAGTGGGATCCATAGGAAAAT
GGCTATTAGCGATAGAAACTGGCCTGTTCGCGCATTGACCACTGCCACAAAGCTGATCAAGAAAAATGCAGTCACATTTGACACTAACAAGGGCTGGTGG
TACTTTGTGAGGAGCCGATAGCTAATATCGTAAACTTTTGCTGGTAGGAGTTCTCCTCGGAGGGACTTGGACAAGTCAATCACAGGCAGTTGCTTTGCAG
GCTTGAAAACGTAGAGAATATCTGGGCTAGTAGCACCAGCAGCAACGACTCGTGCCATCGAAAGCGTAAGTTGTCAAAAGCTTTGGCGAGGTTTTCGTTG
CAGTCCACCAGATTAGAAAAAAAGCGGAAATAAATCGACAAGATAACCTAAATGTAGTTGGGATGAAGACTAAGAAACCAGAGATGAGGATTACATGTAT
GAAACTGTGACACTGAGTACTATCGAGGCTTTAGACTTCAGTTCTGCTTGAAATTGCGATCAGAGATTTTAGAAGTGGGCCCTAATTCCATTCTTTTCAT
TTTTTTTCTTATTCTTCCCTTTGATAAAGATCTTGCCTATGCTTGCTGGGTTCCAGATAGCATGCCTCGGTGAAAACGAGCTCCGCTTACATGGGTTTCT
CGCAATGGAACGACGCAGCAGGAGATACCCTACTACGACGAGAAAACGAGGAGGCCAAAACCTTCAAAACAACTACTTGAGAAATGTTTGAACTTCTTCT
CCCTCTCGCGAAAAAATTGTCGTAGCAGACTGTGCCTCGAAGAATCGACACGTCGTCACTGGACGCCGAGGCCAGCCGTACAACTAAGCGCGAACACCAA
AGCGATAGCGTTAACGATCGGCTGACGTAGAATGGGATTAGTCGTATCCCCACGTGCTGATTCCAGATAGTCCCCTCGAAAATGACCGTATCTCGAAGCT
CAGTATTGTCGACGAAAAAAATCCGATACATTATCCGAAGATGGTCGATAAGCAGAAGACATAGTACAGGTGCAGCATATCGAACGCGGAATTTCAACAT
CCTTCGTGCGGTTGGAGTCAATGCATCGAGTGTAAAAACCCATTGAGCCCATAGCCACCATGATAAAAATGTAAGACAGCGCGAGATATTCCAGTTGTAC
AGGATACAAACGCCGATATTCGCACACGTGATTTGAAACGAGTAGAAGGCAAAGTCGAAGGAAGTAAAGAGGAGCTTAAGCAGTTGGCGCTGGTACAGCG
CTGTAAAAACACCTATAAACGCAGCGGTACACAGCAGCCCAGTGAAACATAGCACACACATGAGTTCTTCCTGTGCCGCAATACCTTGTAACTCGTGAAT
GAGGGGGATCTGAGAGAGGATTAATCCTCCCAAACCAACGGTATAGACAATTGAAAGACACCAAGTTGGAAAACACGTTTCCTCCACGATTTTGCAAGGC
AGGAGAGTGTTGGTAGCGTCAAAAGTCTGCGAGAACTTGACAAACATCAAGTGCTGGATCACATCGGCACCTCGTAGTGAGTTTTCTTTCGATTGACACC
TGGAACCTTCACTAGTCCACGCTAGCGAAAGTGACGGCCCGGCAACAGACTCCAGTTTCAGTCGACATCGATAAATGACGCACTGTACAATCGCTGATGA
TCTTTTCCTCATATGAAGATCTTTCCGTCGTCGGAAAACTACCTTGGCAACTAGGAAGCCTAGTGACATCATTCCATTCCCAATTACGTCGATACCGGAG
AGTTCGTAACTTCTGTCCATATTCTCGTAAGTTGCAATGGTGAACGTCGAGCTGCCATCAACTTGACGAAGCAAGATCCAAGTGAGCACAACAGAAGCAG
AGAGGATTGTAACGACCAGGAAATACGTTAAACTTCGGAGTCCTAATACATGCGCGTCGACCAAAACAACGTGGTGGTATCCAATCCAATCAATGAGCAT
CCGCACCGATCGTAAATCGCCAAAGTACATTGACATTGTGACAGTGATAGTGGTCGTAATTGCGGAGAAAAACCAAAAGTCGAAAGTTCGAGAAACCAGA
CGTACGATGTCGTATCTCAGTGTGGTAATACTGCCCAATCCGAGCGGAATCCAAAAGAGAGCGGCTAGTACCGCAACTATTCGACCCAGTTGCACGTCCA
CCAGAGGAACGAAGACATTCAAGCCATACGATATCGTAGCACAAACGAGGACTTCTCGATAATGCTTGTAGTACTTGCGACGGATAAACGTGTGGACTCT
CCCAGGTAGAAGTCGATCTCGAAAAGACTTGGACAGATCCACTACAGGAAGAGGATGCGCAGGTACCAACGCGTAGAC