Description :
From Genome Similarity Track
Location :
Scaffold_222:53657- 58878
Sequence
5221 bases(100 bases per row)
TATAAATATAAATCAGTTTAAAACTAACCACGTCTAGGAAACTTGGTCCCCTGGACAACCGTGTGCTAGAGCTTAGTTAAGGAACCAACTTCCTCTGTGA
TTGTGCTGTGTGACCCCGTCACACCCTGGTAGGACTTGTAGTCAATCCCGCGACCAAGGATTGATACAATCCGCAAGTCGTATAACATGGATGACTTGGA
AAGTAAGATGCCTTTGAGGCATGACTATACTCATCTTTCGGATGCCCATTGGGCTACGTTGGAGCGAATGGTTAGCCTCTTAGGCAGGGAGACTTTCGTC
GGGTTCTCCTCCCTAACCGCCGAGCAACAGCGTGCTCGGATGGAGCGACTTGAGAGCTATGAGTCCTCACTCATCGCTCATGTGAGCAAGACGGCGCAAG
AGGCGGCTCGTGCCGTCTTCAGAGCCGAGGCGCAGAGCGCTGCTCCGACGCAGGTGTCGTATACGCCACGTCCAGAGTCCTCGAAAGCTGTGAAAGTTAG
TGTCCCTACGTTTGATGGGAAGGAAGCGGACAGCTTGGTCTTTTGGATCAGGGAGATCGAGATCGCGCTGAGCGCACGCTAGATTCACGACTTGAGGTCC
CAAGTGGCCTTTTCCCTTTCAAACCTGGGAGGTCGGGCAAGGGCGTGGGCTATGGCCAAAGAGACAGCCACTCCGGGATACTTTGTCTCGTGGGAGTTCA
TGGCGCAGGAGATGCGTCACACATTTCTCCTGGCCAATGTGGCGTACCGTCATCGGTCTTCGTTCTTGCGGAGAGCAAGGCAAGAGGTCCTTGCAGGACT
ATGTCATGGAGCTTCAGAACTTGGAGGCTGCCATGGCAGGGGCTCCGTTGTCGGAAGAGGTGAAGGTCACCGTGTTTATGGATGGTGTCCGGGTCGGACC
CGTCCGCACGGAGCTCTTTCGTCGTCAAGCGACCACGTTCAATGAAGCGGTACATATCGCTTTGTTGTAAAGTCACTGCATGCGGTCGGCCCAGGGCCAC
GTCGGGGCTACGGAGGCCTCGGATGGTTCTACCCCCATGGATTTATCGTCGGCTGAGAAGACTCGCCCACGTTAAGGTGCGTGAAGGGCCGGTGGCCGCT
GTTTTGGGTGCAATGCGGTCGGGCATTACCGCAGAGATTGTCTTAAGAACCCGTGGAAGGTTGTCCACGGCAAGCCAGCTTCAGCGAAGCACTCTCTTAA
CGCCGTAAGCGTTGTAGATTCGGGAAACGTCGATTCCCAGTAGGTGCGGGACGCCCTACTGGGAAGTCAATGGCTTCCAAGACGGGAGAGAATTTACCCC
CTCCTCTTCCTGGAGAAGATGTCCCGGGGACAACACTATTGTGTTTGTCTGTGGCCGCGGTGCGGTCAAACTTAGTGGTGGTTACTGCTAGGGTGAATGG
GTACGATGACCCCATGACGGTCTTGATAGACTCAGGCGCGTCATATAACTTAGCGACGAAGGCTAGTGTGTCGAAGAATTGGGCGCTGTATACCAAGGCT
GTGGAAGACTCCAAGAGTAACAGCAAGGTGTCAGTTCGCTTAGCGACAGGATCGATTGTATCGAATCGCAAGGTTTTGATACCTTTGGTAATCAAGTTTG
ATGAGTTTGATTCAGAAGAACCGTTCATCGTCTTGGACATGGACGATCGATACGATCTTATCTTTGGTTTATGAAGCATAAGCCATGGATCGACTGGCTT
AGTCGCACCGTGGGTGCTAGTCACAAACCCCTTGTGGAAAGAGCTTTCGCGGGTCATGTCCCCTCCTTGTCTCGCGATGGATTTGTGCACGAACATCACA
TCCCACGTTTGGAGAGCCTCTTTGCCGGTTCGGCAGAGGCAATGGGTGAGCAAGGTTGTCGCGGATCGACTGATACCTTGGAATGCGTTGAGGCTGGAGC
AGCCTCCGCACGAGAAGTCACAACCGTGGGTGGCGATGGAAGGGGTAGTGCTGTGGTCACTATCGCTCAGGAAGTCGCAACCGTGGGTGGCGGTGCAAAT
GGAAGTATTGTGGTTACTTCGGCTCAAGGAGCAGGTGTCTTTGGACGACATATACATGAAGTAGTTGTGTTTCCTCCTTCATCGGAAGACGCAACCGTGG
GTGGTTGTGCGAGTGGTAGTGCTGCGGTCACTATCGCCCAGGAAGACGCAACCGTGGGTGATTGTGCAAGTAGGGGTGCTGTGGTCACTCCTTCACAGGA
TGTCGTGGTCGTAGATCGAAGCAGCTTGAATGTAATTGCGGTGGAACCGCTTACCAAGCTCGAAGAGTTGTACGGGATTGACGAATTGTCCCATCGGGAG
TTCCTAGCGACCCTCAAGGAAGGTGCGTTAGAAGATGTGGTGCTCATACGTCAGGAAGCGACGTCAGTGGAGCTGAACAGTTCTTCGGTCATGGACCCAG
AAGTGTTGGATGATGAGAACAAGTCTTATCGTCAGCAAAGGTATGGCTCGGCCATCTTGAAGAATCCATCGGATCCGTTTTATCCGCTGCTAAAGGAGTT
TGCGGATGTGGTCTCGGAAGATCCTCCGTCAGTGTTGCCCCTGGATAGCGGTTTACGGCATGAGATTGACCTGGAACCGGGTACTAAGTACTGTACTACG
CGTCAAAGGCCGCTGCCTAAGGAGCAAGTGGACGCAATAGATGCGTTCTTTGCGGCAAATCATGCTGCGGGCATGGTTCGAGAATCGAAATCGCCATATA
CGTCCCCAACGTTCTATGTGCGGAAACCCAATCGGAAATGGCGCATGGTGCATGCTTTTAACAAGCTGAATGTGGCTACAGTTCTGGCTTCGACGCCAAT
TCCCCGCAAAGATGTGTTGCAAAACAGTATGGCGGGGTGCAGCATCTTTAGCGCGCTCGACATGGTCGACGGCTATTACCAGCTGCTGATGAGGGAATCG
GATATTCCCCTTAAGGCAGTGAGTACTCTCAGTGAGATGTTGTGGGAATGGTTGGTCATACCCCAAAGGCTTTCCAGCGCGCCAGCCACGTTCAATCGGC
TGGTTACCCAACTGTTTCGGCCGATGCGACACTTCGCGCAGACGTATTTTGATGACATCTTGGTCCACAGCAAGGCTGAAGGGGACAAGACGGATGTTGA
GGTGCATATTGAGCACCTTCGGTCAGTGTTGATGTGCATGCGAGAGAATCGTCTCTTTGCGAACATCAACAAGTGCCTCTTTGGGGCGGAAGAGATTCCC
CTTTTGGGATGTTTCCTTGGGAAGGATGGAATTCGGGCGGATCCAAAGAAGGTACGGGCGATTGCGCAGTGGCCGACGCCCAAGTCCCAGAAGGATCTGC
GCAAGTGGCTGGGACTTGCAAATCATTTGCACAAATACAGCGAGAATTATGCTGAGATGGCCAGGCCATTGAAAAACTTGCTGAAGAATGACGTGATATG
GTCATGGTCGGGAGAGGCCCAACAGACTTTTGAAGCCATCAAGATGAGCCTACAATCAGCACCAATTTTGGCGTTACCGGACGAGGGTCGTCCGTTTAGT
GTGGTGTGTGATGCGTCTGATTTTGCCATTGGCTGTGCGTTGCTTCAGCTGGATGCCTAGGGCAACGAACGTGTGATTTTGTTCCAGTCGCGGCAGCTCA
AGGCCACCGAGAAGAATTACCCAGTGCATGATAAGGAACTTTTTGAGATGAAGTATGCACTGGTCAAGTTTCGGGTTCATCTGCTAGGCAGTAAACCGTT
CGTTGTCTACACAGACCATGCCTCGTTGAGGACGGCGACGCAGTCGCCACACTTTTCGCAGCGCATGGGGCGTTGGTTGTCATTCTTTGCGGAATACAAC
TTCACGGTGGCTTATAAGCCACGGAAGTAAAATGTGCTAGCTGACGCGTTGTCAAGGCGTCCTGATTATGAGCTGGCACGTGTGGTACACCTTGAATCGA
CACTGTTTGAGCTCATACGCGGGGCGTATTCTCAAGATCCGGACTTTTGAGGTGTTATTGAGGCGCTGGGCACCTCATCGAACGTCGTCAAGCTGACGAA
ACGCCAGCAGGCACATCTCCATCGGTATAGCCTGTCCGACGGACTTCTGCTCTACAGTGTGAATCCTGGGGATGAAAAGCGGGTGGTCGTTCCAAACGAC
GAAGATTTACGCCACCGGATCCTCTACGAGGCACACGATACGCCTGGCAGTGGTAACTTGGGGCGCGAGAAAACGTATACGTCTGTGGCACGTGAATTTG
GTGGCCCCATATGTACAAATGGGTGTGGTCTTACGTAAAGACTTGTGAGACTTGTCAGCGGGTGAAGCCCCTACCGTCCTCAGCAGCGCCGTCGCAGAGT
TTGCCAGTCCCGGAGGACTGTTGGCGCTCAGTGAGCATGGACTTCATCTTTGATATACCGGCAGATAGGCATGGCCATACTGGGATTATGGTTTTCGTGT
GCCGCCTTAGCAAGATGGTGCGATTAGTGGCGGTTTGCCGAAGTGTTACGGCGCCGCAGGCGGCCCATCCCTTCATTGATCATGTGTTTCGACATTATGG
ACTCCCGGAGTCTTTTGTGAGTGATCGGGATCCTCGTTTCGTTTCAGCCTTCTGGCAGCATCTCTTTCGGCTGATCGGGACTCGACTGGATATGTCGACA
GCGAATCATCCGGAGACGGATGGTCAGACCGAACGGGTCAACCGTGTTTTGGAAGATGTGCTTCGCAGTATTTGTGTGGATGAGCCACCTCAGTGGAGCG
CTCAACTAGCGCAAGTGGAATTCGCGTTGAATAATGCAGTGCACTCTTCTACGGGTTTTCCCCGTTCTATGTGAATGGGTTGCGGCATCCGCGTACTCCC
CTATCATTGCCGAGGGCTTCTGATTTGGAGGGGGAGAGGCTGTCGCTGATGACCTAAGAGGTCTAAGTGGTGTTCGACCATCGGTCGAGCGTGATTTTCT
TACGTCTATTGAGACTGGTGAAGCCATTCGGCTCCGCGTAAGGGAAGCCATGGCTGCCGCTCAGGACCTTCAAAAGGAAAACAGTGACCGCCATGGGCGT
CGGAACACACAGGTGTTTAAGATTGGCGATTCGGTGTTGCTAAATGCTCGCAATTTACCTATACACGCAGTGTCGGCTGTAGGGATTACAAAGCTTCGTC
CGCGCTTCGTGGGTCCGTTCATGGTCATTGGTCTGCATGGCAATGCTTACACTTTGAACTTTCCATCGGCTATGGCAACGCATCCAACGTTCTACGTTGG
GATACTTAAGGCCTACCTTGA