Description :
From Genome Similarity Track
Location :
Scaffold_183:53657- 55678
Sequence
2021 bases(100 bases per row)
GAAGAGTGCAACGGGCCCTATCCACGGGTAGACAAGGTTGTAAACGGAGTACCCACTCCGATAGTCGGTCGTCTGGGTGCAGTGGAGAATTGGTACTGCA
TGAGTAAAATCACGAGTCACCAGAAGATGCGAGTGCCCGGTGCTTCTGGTGACTCGTGATTTAACCGTTATTCCGTTAGTGAAGATGTGAAGGTAAAGAT
TGAACCTGGGACGTAGGTTTCAGAGGCAGTGGAATCGCTACAGACGCATGAGTTTGAAAGATCCCCGGATCGTCAGAGTATTGGGGTCTGACTATCGGGG
GATCTTTTTAAAATCGTGCGTCTATTTCGATGACGAGAAAATTATAGAGAAAAATCGATCGATCGATCTGGAAGAGAAACTTTAACCTTCTTCTGAGTTC
CTTTCGGGGACAACCGCGAATCGTGGTGCAAAGCACGATTTGCTGGGTGAAAATCCTTCGGATAAACCGAACCATTATTAACCAGGACCACTCTAACAAG
GTTGAAGTCCAAGGAGCTGAAGACAGGACGAATGTAGTAGAAAGAAGCGCTAGGATAGGATCTAAACGATCCAGCCACGAGATCTGCTATTCGACCGATC
CAGCTTGTGGAAGACGATATGAAGACGTAAGATTGGCAAGTAGGCGTGATGGCGATGGAGTTGCACTGGAAGACGCTCAAGAAGTTGATATTGAGAGATC
ACGTGCTACCGAAAATAAAGCCAAAGTTGATCGGCTCGATTCAGGGTCCTGTACCAGCCCCAGCTGTAGCGTCGAATACACCAGAAGTGATCGATGGAAT
TATTCAGCTGCAACGGATGGCTCGATTCGTTGCGGGATCATTCGATGCGAAAACTTGTTGGAGTGTGAACATAGTCAGTGATCCATGCGTGTCACTCGCT
CTATGAGAAATTTATCTCTTTAACAGCCTAATGTGACTCCTTGGACCAATCGGACATTAATATTGCAGATATCCCGCGAGAATACCACACGAGATCGGTG
CAGCATCCTTCGGCTGAATCCGATATTGAGCCGGACGACTACATCGGCATTCAGGGCATGTCTTTAGGACCAAGTGGGGCAGCACATTTGAGAGATTGGG
TTGGAAAGGTCAAGACTGGACCACTATCGGCAGCAGTACGCGCTAGCTTTAGGGCAATTCCTTTTCAAGGACACTTGCAGTCCTACTTCGACGCGGCCAT
GGAACGGTTCCAACAAGAACGATAAGAGCAAGCCCGTCGAGATATCGACTCAAGTGAGAGAATCAAAGATGAAAGAGAATTATGTATTCCAGATATCGAG
ATGGGATCGGCTGGATTGCATCTCAGTCGATCTAATACATACGATCCTGAAGATATCGATCCCGACGACGCGGGGCAGGAGGATCAATGGCGTGCGTTTG
TAGTTGTCACAGAAACGTTGCAAAATGGTACTGCAATTCCCTAGCGTATACGTGCGTCGTTGATGACGGAGTTGAAGGAAGTTAGCGGCAAGGACAGAGA
TGAAGATCGGGCTAGAAGTTGGAACAGCAAAGCCAAGTCGGCGTTCCTGCGCGATCAAGAGCCAGACGAAGAAATGCGTGTGGTGTTTGGCGATCTGCTT
ATATGACCGGCGTGGAATTGGTATAGTCAGCTGATTCGATTCTACACGGCATAAATCGAAGCCGTCGCTGAATTGTTTTCCGGTACAGTATTTAGGACAG
GGTATGCCAGTGGTCAAACAATATTACCACGCACGAAAGTAATTAGACGTATCCCCGTTGAAATGTATGCATCGTCTTAACGTCGCGGCGGTGCAGGCCA
AGATCGCGATCTATGAAGGAAAATTAGCTACACCGGCCACACGTCGCGTGCATATGGAACATTTCATTGCTACGCTAGATGATCGCGAGCTGGCCAAACA
ACTGACTCTACTGAGGTCGACGGACGCTAATGAAATGGAGGACACGCTACATGCTTACCAGCGGATAGAGACCCGCCAGACTAAAGCTTAGATGGGATCA
AGCAAGTTCCATCAGCGAACG