Description :
From Genome Similarity Track
Location :
Scaffold_15:53652- 56318
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G006549Similar to ABCC1: Multidrug resistance-associated protein 1 (Gallus gallus)

Sequence
2666 bases(100 bases per row)
GCGGCAAAGGTGTTCACGGCAATCGCATTGTTCAACGCCATCCGGGACCCTCTCCGAGACTTGCCAAACGTGATTCAGACGCTGATTCAAGCCCAAGTCT
CGCTCACGCGTATGGCTGAGTTCTTGGAGCTGGACGAGTACGACCCGGCAAACGTGATCCGAGACGACCCTTCGCAACCAAAAGACGTCGATATCGCGAT
TACAAACGGTTCGTTCGGTTGGGCTAAGGACGCTCCACTTCTCAAGAACGTAAACGTGACGGTGAAGAAAGGCGATCTGGTTGTGATCCATGGCGTCGTA
GGTGGGGGCAAGTCCTCGTTCTGCTCCGCCCTGCTGGGCGAAATGGAGAAAATCTCGGGAAGCGTGTTCGTTCGAGGTCGCGTCGCGCACTACTCGCAGC
AGACGTGGATTCAGAACATGACAATTCGCGACAACATCCTCTTTGGAAAGGCCTATGACAAGCAAAAGTACCAGGAGGTGCTAGATGCGTGTGGGTTGTT
GCCAGATCTTGCCGGGTTCCCAGGTGGCGACGCGACTGAAATCGGCCAAAAGGGCGTGAACCTGTCTGGCGGTCAGAAAGCGCGTGTCTGCTTGGCGAGA
GCGTGCTACTCGGATGCGGATGTGTTGATTTTGGACTCACCGCTCGCCGCTGTCGATGCGGTCGTGCAGAGTGAGATCTTCGGTAAGTGCATCTGCGGCT
TGTTGGAGAGCAAGACGATCGTTCTGGTGACCCACAGCCCCGATATCATCGCTTCAGATGCGGCAAACTACAAGATCCTGGTTGAGAACGGAGAGCTCAA
GGGAATCCGATACGAACCGGAGAAACCACGTAGTTTCTACGCGCCAACGGTGTCTCCACGGATGATCAAGAAGGCCCACGAGCACGAAACGGAGGAAAGC
AAAGCTGCGATGGCCGATGCTGGTCGCTTGGTCAGCGACGAAGGACGTGGTGAAGGCCGCGTGTCCAAGACGGTATTCCTGAACTACTTTAACGCAATCG
GCGGCGCGAAAGTGTGCGTGTTCCTGATCTTGACACAAATTGTGTGGCAGGTGTCCCAGGTGAGCAGTGACTTCTGGTTGAGCAACTGGACTGGCCAGAA
GTTCGGTGCGTACAACGAAGAAGAAACCGAGTACAACATGATCGTTTACGCGATCCTGAGCTCCAGTGCTGCTCTGATGGTTCTCGTTCGCACGCTCACA
ATCGCTATCGTTGGTCTCCGTGCCTCAAAACAGCTATTCGATATGATGACACGCGCGCTACTCAGTGCTCCACTGCGGTTCTTTGACGCAAATCCGATCG
GGCGCATCGTGAATCGCTACGGGGACGACGTGTCTACCGTCGACTTCAATCTTCCGATCGCATTCGGCTCCTTCTTGTCCATTTTCTTCTTCACAGTGTT
CCAACTCGCGACGGCTGTCCATACCGTGAGCTTCTTGGGCTTTTTGATCATCCCGCTTATCTACATGTACGTCAAGGTGGCCAACTTTTTCCTTGGGCCG
TCTCGAGAGATCTCACGAATCATGAAGACGACGGCGTCACCGGTGTTGAGCCATGTCAACGAGTCCGAGGAAGGCGTCGCGCTCATTCGAGCCTTTGGTC
CCGAGTATGTGGAGCGGTCACTGGTCGAGAACTTTGCGCGAATTGACGTGAACAACAAGGTGTGGCTCGTGATGAACGTCGGGCGGCAGTGGTTTCAGGT
TCGCATGCAACTTCTCGGGTGTGGTGTTGTCATCCTCGTAGTGTCATCCCTGGTGTACCTTCGAGACATGGTTACGCCCGGTCTTGTTGGTCTGGCGTTC
ACGTACGCTCTTAGTGTCGATGGTCGTCTCTCGTCTTTAGTGCAGATTTGGTCGTGGTTCGAGATGATGATGGTGAGTCCTGAACGTATCTTGGAGTACG
CGGCGATCCCACCTGAGGGTAGCGAGAAGACGCTTGTCATCGAACCTTCCCCCGAATGGCCTCGCCATGGTACCATCAAATTCGACAACGTCGTCTTCAG
CTACAAGGAAGGCGCTCCAGCTGTGCTCAAGGGACTCTCATTTGATATCAAGAACAACGAGAAGATCGGCATCGTCGGTCGAACCGGTGCTGGCAAGTCG
AGTCTCACCATGGCGCTCTTCCGAATCAACGAACTGGACACTGGTCGGATCTTGATCGACGGCGAAGACATCTCGACCATGCCTCTGCGCTCTTTGCGTT
CCAAGTTGTCGATCATCCCTCAAGCACCAGTTTTGTTCAAGGGAACCCTCCGTGCCTACATGGACCCGTTCGACGAGTTCACGGACGCAGATATCTGGTC
GGCGTTCGAGAAGGTCGAGATGAAGGAGCAGATCGGTGCGTTGGAGAACCAGTTGTCATACGAGTTGAGCGAGAACGGCGAGAACTTCAGCGTGGGCGAG
CGTCAGATGCTATGCATGGCGCGTGCGTTGCTGACACAGACCCGCATCGTGGTCATGGACGAGGCCACGGCGTCGATCGACCACGCGACAGAGAAGAAGC
TGCAGACGATGATCGATCGCGACTTCAAGGACGCGACGGTGCTGACGATCGCGCATCGTCTGGCGACCGTGTTGGACTCGGATCGCATCATGGTGCTGAG
CGACGGGAAGGTGGTGGAGTTTGATTCGCCGGGGAACCTGGTGCAGAACCCAAAGGGTGTGTTCTA