Description :
From Genome Similarity Track
Location :
Scaffold_1:5364804- 5365934
Transcript NameFunction/comments
Physo_258180ATP-binding Cassette (ABC) Superfamily

Sequence
1130 bases(100 bases per row)
TTGGTCAGCTTGACAAGCCTGTCATTCTTCAACTTCCTTTCACTGCATCAAGCTTCACTCCCACTCGCCCATTGTCTAGCCGAGATGCAGCTTTTTGCCC
CGCTCCTGGTAGTTCTCGCCGTCTTCTCGTCTACCACCACGGCCAAGTCCGCGGAGGAGTCCAAGACCATCGACGATCTTTACGCTGATGCGGTAGCCGA
AGGAGGTAACCTTGTCCTGTACCATGGCGGTGACACTCCTACCCAGCAAGACGGACTCCACGCAGCCTTCACGCAGCGCTTCCCGGAGATCAACTTCACT
GCAGTCGTTGACTACAGCAAGTACCACGACGTCCGCATTGATAACCAACTGGAGACCGACACCCTCGTCCCTGACGTGGTCGCTCTTCAAACGTTGCAAG
ACTTCACGCGTTGGGCTAAGGCTGGCGTGCTACTCCCCTACAAGCCTGCCAACTTCTCCAAGATCCACGACTCGCTCAAGGACAAGAACGGCGCGTGGAT
GGCGTACACGATCTTTTCTTTCGGCTACATTTACAACTCAAGTGCGCTCGACGGTGTAGCGGCACCTACCACCCCCGCCGATCTCGTAAACCCGCAATGG
GCTGGCAAGATCGCGTCAACGTACCCTCATGACGACGACGCTGCGTTGTTCCTGTACACTCGCTACGTGGAGAAGTACGGCTGGGACTGGGTCTCTAAGC
TTGCCCAGCAGAACGTCAGCTTTAACCGTGGATCCAACGCCGCCGGAGAACTTGTGAGCTCCGGGGAGAAGGTGATTGGCGTCGGAACAAGCGGCTTCGG
TGCTTCGATCGAGTTCGTTGGCGGCAACGGCACAGACTTCCTCAGCTGGGGGCAGCGTGTTGGCATCTTGAAGAAGGCCAAGCACCCCGCTGCTGCGAAG
CTTTTCATGAACTGGGCCGTATCCGAGGAGGCCCAGACGACGGTGGTCTTCTCCAGTGTGCCAGCACCGACAAGCCCTGGGACATCCCGGAGGCGAACAT
GGCTGCCTTCCCCAAGTTCATGGAGGACCGCGCCAAGGTGGAGCAGTGGAAGCAGACCTTCGCGCTGTACTTCGGCGAGGTGCAGGGTGAGCCGAGCCCA
GGTTTCCTTGGGCTGCACCCTGGTCAGTGA