Description :
From Genome Similarity Track
Location :
contig_15:536294- 545325
Transcript NameFunction/comments
g3460.t1hypothetical protein

Sequence
9031 bases(100 bases per row)
CTTCACTCGGCACCGGGACGAAGCACCTTCGTAGGACGAGCTGCTGCCGACGCGGAGCCCTTGAGCACGGTGTGTTTGCGCTTGCGCAACTGCTTGGTAC
GACGCTTTTGCTCGTTCTTCTGCATCCGGCGCTGGGCTGCCCGCTGCGGGTCGGCCACTGCTTCGGTGCGGCGCTGAAGTTTCCGTGCGGCGCGACGCGA
CGCCATCTTCCTCTGCACGAACGAGTAGGCCTCCAAGAACGTCGCCGCTCCCAGCTTTTTCTCCAGAAGCTGCAGCACTTCCTGCGCAAGTAGTGCGCTC
TCAGGTGGTGCCACGGACTCCGGTGCAGGACCGCTCCTTCGGTTCTTGTAGCGGTTGCGCTGTTGTTGCTGCAACCGCACCTGCTCCTGCTGAGCCTGCA
GCTCTTCCAGCTTGCTTGAAGCTCGATACAGCGGATTGATGATCTGAACAACATACTGCTCGGCGAAGGCCGCGTCGTGGCTGTGCAGCAGAGCGGCGAA
CAGCTTGAACACCACGGCTTGCACCTCGTTGCTGCAGCTTGAGCCGCGTGCAACGTACGAGAGCCGCGTAAGCAGCCAGCCCATGGGTGTACTTGCCTTT
GCGCGCTCCTCGGTCTTCTCCTGCTCCTCACGACGCTGCAGTTCCGCCTCGTCCTCGTCAGCCTTCTTCTCATCAGTGGCAGTGTCCTCCTCATCCCCAC
CCGCATCCTCAGCTTCAACTTCAACGCTTGTGGCATTCGCCTCGCCATCCTTCACGGAGTCAGCAGCGGCAGCCGTCACGTCCTGCGGGATATCGGTTGT
CTCAAGCGCTTGGCACAGGAACGGCAGCGCTGTAAGAACCTCGCTAGTTAGCTCGCTGTTCAGTGCCGGTGCCTCCAGCAGCTTGCAGAAAGCACTAGCC
CAGATGAACAGACGGCCAGGACGCTGCAGATACAGCGCTCCATTCTGCAGACGCTCCAGGGCATCTCCAGATAAACGCTTCACCGGAGCTGCAAAGGCAA
GCGTGCTCGCTTGGCGGCGGCTCAGATACGACGTCAACAATCGGGTTGCGCCAAGACGCACCCAGGCGTGGGGGTACTGAAGCAACGGCAGCACCACCGC
GTCCAGGAAATTCGTCGACACCTTCAACTCCTCCAGCCAAAGCTCGTAGGGACCAGCAAGATGGTCGCTGAAGGCTCTAAGCGCGACACAAACATGGTAT
GTCGGCTGCCACCGCACCTGATCACTGTCCTCCACAGTCTGAAGCTCATGTAGACTGCGCTCGAGCGCTGTGCGCGTCGCAGCCAATACCTGAGGCGCGC
TGCGCTCCATGAATTCGGGTCGGGTTTCCAGCACAAGCGTCGTCACCTGAGCTGCAGCCCCGAGTAGCTTCACCGCATCCGCAGTATTCGAGTTTGCTGC
TTGTGTCCACCACGTGCACACCAGCAGAATGCTCTCGTTCAGCTCCTTGTTGCCAAGACGACGCACAAGCGTGCTCAAAGCTGCCCGAGCCAGGTCACGG
CACTCCGAAGCCTCGTCGTTTGCTAACCGTAACACCAGCGGCAAGAAGAAGAACTGGGACCGAGCGTTCACCAAATCCTGCGGGAGCTTCGTGAGAAGCG
AACGAAGAGCCTCAAGTACGGCAGCGCGTCCAGTAGCGTGTCCGTAGCTCAGGTTGTCCACCAAGAATTTGAGGTGACGAGACAACCGCTTGTTTCCAAG
AGGGTACTCAAGCAGGAATGTCTGGTAGATGGTTGCACAGTTTAGGCGCGCACCCGGGGCATCGCTCTGAACAAGTAGCTCGCCAACACGCAGCATCACG
TCGTACACCTCGCTCACCACCAGATGAGAGTTCACAATGGCCTTCAGAAGGGCGAATGTGGCGTTCTGGTGATCTTGCTCGTCAAGATCGGCTCGCAAGA
AACTCAGAAGCACGCGAAGTTGCGGTTCCGTCAGACGCAACGCCTCGTTCTTCGAGTCCTTGGGCGCGTTGCCGTTCTCCTGTGCGAGTTCCAATCCTTG
CTGTTGTCTAAGGAGCGCAGTAAGGGTGCGGTAGCATGTCTGCACCATCTCGTTGCGAGTAGCAGCTCCAGCCTGCTGCAGAATCTTAAAGAGGCGGTCA
AGAAGAGGTGTGCGCGCCACCCGCAAAGCAGGGAGCTCTTCCTGTCGAGGGAGCATTGAGCCAACGCACTTGAGCGCGTTGATAACAGCTCGGTCGTTCT
TTGACTCGCCAGCGCAACGCATCAGCAGAGGCACAAGCGGGTCGACGAGCTGGGCCGGAGCGTCTGAAATCTTCTCTGCGTCTTGGTTCTTGGAGCTGCC
ACTCTTGCGGAGGAAGGTGAATACCAAGAAGACACCAAAGTTTAGAAGCTCTCTCAGATGAGCGGTGCTCTCGGCTAGCAGAGCAGCAATCGCCTCGCGC
TTTTGCTTTTTGGTCTTGCTTTGCTGTTGCTGGCGCAGTTTATCAAACCCAGTGACCTGTTGCTGCATCGCAACACGTACAGTGTCCCGGGCTTTCACTC
GTGCGGCAAGCAGTTTAGTGGCTCGCGCACTCTTCTCGGACACAAGCCACGAAGTCACCAGTGCCGTGCTGCTACCTGCCGCTTCGTATTGCTCCTTTTC
CCTCTCTGAAGTCGGGCGCAAACTCTCCAGGCTCGAGTTGAGCACATTGTACGCGTAGAGGAACATGTAGGACGATTCCACAGAGGGGTTCTTCGCAAGG
CCAATCGCTATGCGCTTCAATGCTTCCTGCAACGCGGCCGTAGCTTGAGCCCCAGCGTCTGTCGCCTGGAAGCGCTTTACAAGAGCACTTACGACCTCGT
GGATGCTTGGATTGGGCAAGAACGGCAATGATCTTGCCAGCAACTCCAGCGAGTCCAGGCTTCGCCCACCGCTCGAGCGGGCCTCCTTCATCTTGGATTT
TTGAGCCGATCTCCGTTCCACGCCTCCAGCAGCAGCCTCCGCGGCCTCGCCGATGGTAGTCATACCCTGGAATAACTCTGCGGCGAGAATCTCCATCAGG
CTTGGCACGCAAGCATCCAGAGGGGATGCAAATTCAGCCTCGCTCTCGGCTTCCTGCTGCTTGTCTTGCATAAGCAGCAATGATTGAGGCTTCCGAGGTG
GGCCGGCGTGTCCTTCACTCTGCATGATCTCGGGGAGCTTTTCCAACAGGGCGTGCACCGTAAAAGACAGCACATGGACCATGTATCCATCGCGCAGAGT
GTGGCGAAGCTCCTCCACAATCGGTAGTAGGAAGCGTGCACCAAGCTCCACAGCGATTCTAACCAGCGTGGTACGAGCTGAAACACGCACAGCTTCATCC
TTATTTTTCAGCAAGTTCGCGAAACGCAACAGCAGCTTGGGTAGCTCACGTTGGAAGGTCTCAGCCCGCAATCGCCGCAGCACCTTCACGACAGCCAGCG
CGAGAGGCACACGGACAGAAACAGACTCCTCGGAGAGCGAAGATGGCTCGCTATCGTTCTCTGCTTCTTCGAGCTCTTTTTCGAGCCCGCACTCTTGAAC
AGATATGAGTAGAGCATCGGAAGAACTTGTGTCTCCATGTTATCCTGCACCTTGGAGGATCCGTCTTCATCTTTCTGCTCAGGCTCGGAGGGGTTGCTGT
CAGTGTTCACCTTACTGGACGACAATTGCCACTGAGTAGCCGCACCCGGCGCCTCGAAGTGAAAGTGGTCAATCACTGCGCAAATGGACATAATGATAGC
GCCTTCCATTTCAACATGACCGTCGATCGACTTCAGCAGTCTGCGAAGCAGTGACAGGTAGTGCGACCAGCTCAACAGGCCAGCAGCACTGCCTACGCAC
GCTGCAGCTTCAGCGCGCAGAGACTCCTGGCTCTTTGCGTGTGTCTCGTAGACAAAGTGCAGCACCAGAGGGAGGATGACACCATTCACCGTCGAGTTCG
AAAAGCACACAGGTTCTCCAATTTCCTCACCATCAACTTGACCCTGGGCCTTACCAGCCATGGAGTCCATGAGAGCGCTGAGACGCTGAAGGGCACGACG
TCTGCGGTGAGCTTGAATGTGCGTAATGTTGTAGAAAAAGTCAGCCTCTGGGTCCTCGTGGTTGCGCGCCAGCACCAGATCTGCTGGAATAAATGCAAAC
TGTCTAAATGCCTTGTGTTGGTCCGCCAACGATCCCAACAGAGTCACAAAGCCTCGCCGCGCATTCTCATCAGTCGAGCGCAGACTTGCCCGCACGCAAG
GCATCACCAGCGACTCCAATCCATTAAGCACAGGAGACTTCGCGGCATCGTCTTGCCTGCTCTGCTCGACTGCAATCTCTGCTGCTAGTCCCAGGAACAC
CGTAAGGCTGGCAAGCGCAGCGCTGCGCACTGAGAATTCAGCGTTGTGCATGGACTGCAGGCACTGCGCCACCAGAGGAGCTAGCAAATGAGTCTCGTGC
GTAAACCCGTCAAATCGTGTGGTGTTAAGGCGGTTTAGCGCAATCAAGCGACGCTCGTAGTCGGTCTCCTCGATTTGCTTAGCGTCGTATGCGTTGAGCT
CATCCAGCAACTCTGCCACGGGCGCCAGCTCTGTAAGCGCAGGATGCGCGCCCAGAGCTGTAAATACCATTACTAGTTTCAGGCGGGTATCACGATCGGC
AATGCAATTCGGACCTGGAGCCAGCAGCCGTGCAAGGGCGAGCACATGCTTCTTAGGCTCCGAGAGCTTCGGCACCAAGTGGGCCAGCACCTCCAATAGG
TTTTCCTTGTCCTTAGGCGACGTCTGGTGGTTGCGCAGCAAGAATGGCAATAGCAGCTGAAACAGATCGTGGGCAGCAATTGCCACGTCTCCGTCAGAGG
CGTCTAGATGGTGCGACAGCCGGCAGAGGAACGTAAGCTCCTTTCGAGATGATCCAGCGTACCGGTCGCTTGCGTAGCGTGCAGCCTTGGCCTGGAACCG
CTGCACAAATTGCTCCAACACGAAAGGGATGTGGCTCACAGCAGCACCTTGTCATCCTCCTTGATGGCAGTCATAGCTCGTCTTCGGCCAACACACTTTC
ATCTCCATCCAGCAATGAATCCATAAACTGCAGGATAGAGTCTAGAATTTCAGGCGAAATGCCACGACTAGATGCGGACGACACGCTCGATGACGTCAAT
CCTGCCGACAAGCATGAGATAACGCTTAGCACCAGAGGCTCCGGGATCCACTGACGTGCCCTGTCGGCGCGACCATTGCGACGAGCAATTCCAAGAGTGC
GGAAGCCTTGCCAGCACCGACAACCGCGTTGGACAAGTGCACAACGGCATCATGCGAAGTTTCCAGCACCGCTTCTACCCAGGGTTGGAGGCGCACGAGC
GTATCAAACTTCATTAGCAAAACATAACAATGGTTAGTACTTTAATTGAACAGTGGATTTGAGAAACCAAGCGCCGTACCGTGTCGATCAACTCTGCGAG
TCGGCGGTATGTCAGCATGCGGATCTGCTTCTTCATCGAAGCAGATGTCACTAGGCTGTCAACAGTCGACGAGGGCTCACCAGCTTTCCGCTTCGTGCCC
ACAGCAGCCCCTGCGTCCTCCTTGTCATCATTATTTTCGCCAGTAGTAGCAATTTCATCGTCATCTTCGCCGGAAGCTATACTGATCTGAAGAATAGCCA
GCAACACGTCTGCAAGGCGAGGCGCAAAAGCGGCCAGCTTCACGCCAAGTTGGTTGATAAGGTCCTCGAGCAAATTCAAGAAACCAAGAATGCGCGAAGG
CTGTACATTGGAGACTGCTACGACAGGTTTCACGTTGTCAGAGATAATAACAGTGTCTTGAGCAAGACTCTCGGGGCTTCAATCGATACATCAAACGCAC
GGACCACAAGTTCCACGAAGCTCGCTAGCTCGGGCGCCTCCAGCGCTGCCAAATATGCTAAGATGGCTGCACGGCGCGCAGCCACCGTGTCACCATTGTT
ACGGCCCTTCTTGCTCACGCATTTCGAGTACAAAACGCGCAGCAGAACAGGGAGCAACTCAGGTCGGTGCTCGCGAAGCACGACCCCCTCTCCGTCGCCC
ACCTTAAAGCTCGCCAGTTCTTCGCGGAACGACGAAGAATCCGTCAGCCGATTCAACTGCGTCTTGTAGGACACAACTGCCTTGTTGCCAAACGCGTAGA
TGCACTGCAAAGCAAGCTTCGAAACCACTTCGTCCGACTTCATCAACAGGTCGAAGAAAAGAGCATGCAGCAACTGCTGCCCGTATGCACCTTTCATATT
GTGAAAGACAGCAAACAGCTTCAGCTGATCAACAAACTTGCAACGCACTTCCTTGGTGGTCAAACCTTGGAACTCAACTGGCTTACGCCAGTTTGGAGAT
GCAGCATCATTCGAACTGTTGGTTGTTTCTTCGAGCTTGACAAGCACCTGGTCAATTTCCTCGAGACGGTTGGCGTCCAGCTCATCCGTGTAGATGGCGC
TATACTGGTCGCGCAAAAATGTAAGGAAAAGCGGTACCATAAACTTGGTTTTGGCCTCCACAAGGTCCGCGAACTTCATAAGTCCCTTCCACATCAGCGA
ATGATGAGTAGGAGCATCTGTGACACTAGATGCATGCACCTTGCCCTGCTCCAGCATGCACACGCGCTCAAACTCCTGAGCAACGCTACTTTCGATACCA
GACGTGCTCGATTCACTACCGTTCGGGTCCTCGTGGCAAAGTGAAGCGGCAAGAAGCTCTGCACTGATGCATGGCCAAAATTCGTTGAAATGCAGCCGTG
CTGCCGTCTCCACTGCATCCGCGATGTGTGGCCAAATCATAGAGAACTTGACGTGGTACAGACCCAACAATTGGTTCAAGGCAATTTTCTTGTACAGCTC
CGGGGTCTGTGGCGAACGACACAGGATCTTCACTCGGGTCAGCAGGCGCACCACTTCTCGTCAGTAGCCACACTGATACTTTTGCATGCGAGCTCTAGGT
TGACGCAGATATCCGGGAGATCGCATGGGCCGCTCAGTGAACCGCTGTCGGAATCAATAAAATCGAGTCGCTTAAATCGAGCCAAAAACTGCAGAGCCAC
TAAGCGTAGCTCATGTGCGGGCGAGCGCAGAGTCGCAAGTAGAGAGTTAGCCAGCGAAAGTAGTGCATCAATCGTTAGAACAGCATGCTGCTTTTCCTCG
GACTCCATTCCAATAAGCATCAATAAAGTCGACAGCGTCTTGAATGACGACTCTTTGCCGCGAATTGCTTGCTCCACATATTTCGTTGTCATCGCCGCAC
CCTTGTTCTTCGTCTGGTGTTTGGCGATCTGCTGCAGCTGCCACAACTCATCGCGCAGCAACTGGAGTTCGGTAGCTGATGAGCCCGACGCAGTTTTCAG
TCGTTTGTCAAGCTTTGTGACTAGAGGAGTAGTGAAGCCGATCATTTTGTCGTCATTCAACTGCAAAAGCTCCAACGCCTTGCAAAATTTCCAGCGCACA
GCGATATCATCGGAGTCGTTTTCGCTGTTAAAGATTTTCTTACCCGCATCAAATAGTGCCTTCTCAGCGTTATCATCGATTTCCTGAAACGAAAGCAACC
AGTATTGACTTGAGTTCTTCGAGCGTACAATGTAAGCGCTCTGGCCGTCGTTGATTTCGCCTGCATGGACTGTCACGTAGTCACCAAGTTGACACAACAG
CACACTGAAAGCACTGACATCAACTTCCACCAGCGTTTTAAGTGCAAACTCCATAGCGTTCGGTAGCAAAAAATCAATGACAAAACCCACGTCGACGTGT
CTGTTGTGCAGCTCCTGATCAACAAACTCCAACAGCTTTTGACGCCAGTACACTTGCTCGTCCTTCTTCGCTGCTACTGCAAAAATCGCCTTCACCTGGG
TCGAAATCACATCGTCTTCAGCGGGGAACAGCCGCCACACAGCCTCAAAAGTCTGCATGAGTACGTCCCGCAGGGCATTGCTGCGGGACGTGAGAACCTT
GTTCTCAGGAGAAACCAGCGCTGCACAAACCTTGTGCAGGCTCGGTACGCGCACCTCGTACGCGTTACTAGCGCCCGAAAGCAGACTACCCATTCGCGAA
ATCAAGAAGCCAAGCAGAACGCTCAGTACGCGGCTCAAATACAGATCGTCCGCGTCAGTAGGGACATCGTCTTTCTCATGGCGAATATTCGCCACCTTGT
TCACTACGAGTACCAGGCACTCGAGCATCTCGCCCGAATGGTCGGCATCCGTGTGCTTCATCATTTGCCCACACGTTTGGTATACGACCTCAAACATCGC
CTCCTGTTGCTCAAGCTGCTCCTGCGACTCCTCTGAATTCTTCGGTCGGAACGCTCCCAGCAAAAACAGCAGCACCTCGCGCATGCGGGAGTGGAAACCA
TGGTTCACATTGCGCACGAGCGCGAAGAAGAGCTTGGCCGACCCATCCCTCAAGATATCGTCGTTCCGCCCCGAGCCCTTCACCAGCGCCGTCAAGTACG
CACGCAGGTACTTGCGCATCGCCTTGGGGGACTCGATCCGTCTCAGCAGCACGGCCAGCGTCTGCGCTGCAAAGTTGCGGACAAACTCCTTGGGGTGGCC
GAGCAGCGGGAAGTAGCACTTGTGCACGGCGTCCATGTCGGCTAGCAGTTGAACGCGCAGGTAGCTGAAGAGCATCGTGAGCGTCTTGAACACTTGTGTG
CTGAGCTCCGGGTCCTTTGTGTCGATCACAGCCACCACCAGAGGCAAAACTCCACCAAAGTGCGGGTAAAACTCCTTGCCGAGCTCTCTGGCCAGCGCCG
TCACGAGCTTGAGCACGGGCACGAGCCGCTGACGCTGCACGACCGGGTCCGCATTGTCTTCTCGTGCGTCTTTGAGCTCCTTCTGCAGGCGCTTGATCAC
CTTGAGAGGTGATGCAGCAGTTGAGGAGTGGTGGTCACCAGCGGCTGCAGTGCGCGGAACAGGAACTGGAAGCTGTCGAGCGTCGTGAGCTCCGCCTGCA
GACTCAGTTCCTCCTTGAACGAGAGCACGGAGGCCTCGTCCACGGCGCCCGTGCTCTTGGCATGCAGCGTGAGCTCCGTCTGTAGGTTGCTCACGCGCTC
CTCCACCTTCTGGAAGCGGTGGCGCCGTTTC