Description :
From Genome Similarity Track
Location :
Scaffold_176:5362- 6963
Sequence
1601 bases(100 bases per row)
CTTGTTCATGAACCCACTGCAGAGCGGGTAGCTAGTCACTCCTGGTGGGCAGTCCATTGGTTTAGCGCTCCAGCTGAAGCTCATTTCTCCTTCGCTCTTG
CTCTAGAGCCATTGAGCCAGCTCGATGTTCTCACACTCCACAGCCGTACAAACCCCCTCGGTCAAATCAAGCTCGCTGTACAGAGAATGATTGAATTGGT
ACCTACTTTGCCAGCTCTGTATTCCCGCTGCGAACGGCACATCGTCCAATGTCCGCATCGCCCAAATCAAACACACCAAGATGAGCGATTGTGAAGCCAT
TTTGCAGCCTCGAGATGGTCGCAATCGATTGCGGATACCACTGCAGCATTCGCGCATCCGATGGTCTTCGGATGCTTGTATAGCCATTCCAGTGTTTCGA
TCTGTCCAGTCGATGCGGCGGCATCCATCGTTCCGGGATCCACACGATGCGTTCATGGCGATCTGCGAGCCACGCCAGCAATCAGACACTCCCCGTCTTC
GCCACCTCGATCGTCACGCTGTATGGTACTACATTGGGGCAGCGCGCGTGCAGCCACTCGACCATCTCCAGGTTGTCGTGCCTCACTGCTGAGACCAGTC
TCTGGTTGCACAGATACCGAGAGTAGTATGGGTCGACACTAACTGATATCCCACGAAGAGCAAGGCGAGGGAGCAACGACAACAGGTTCGCTTCACAGGC
GTACAGAAGGCCCCAGGGCCGAGGCAGCCCGCAGTCGAGAAAACCGCCGACCGCTGCGACGTGCTGCAACGCGGCGACCTGCGCACCTGCCACGGCACAC
AGCGCCACCGCGATAGACGTAAACGGACGAAGGCGCGGCAGTGCTGTCGCCGATGATGAGCGCTCTCTTGATGTATTCGCCATTGCGTATGGGGCTGGGG
TTTCGGCGAGTTCTGGTTCGTTGGGCAGTCGACTGACTCCAGTGAATGAATGGAGCGGGAGACACTGAAACAGGCTGACTCGATTGTCTTCTCAAGTGCA
CATGATTGCCGATACCTCTTGCATGCGTCACTGATTGAGGTTGCATATATACGAACTGAAACATCGGTGATGATTCGAAATATACTTGAAACATCTGGGG
CCATCTAGCCTGAAGATCCCTAAGATTTTATGTCTTTCAGCTCTTTCGCAGATTTTCCAGGTGCGTCGCCCGAGCAAGCTACTCCCGCGACCCTGGCTGA
ACAACATGTTTGTTGCGCTGGTCGTGGCGGACTGTTGGTCCACCCCGGTGCTCCAGTATTTGCTTCACCGTCACCAGGGCATGAAACGCGTGCTTGGTGG
TCGGTGCAGTGCTGAACATCGGATCGAGCATTCTTATCTCACTGGTCGTCTTTCTACCGTACTGCGAAGCTTCCCTGGCTGAGTACTTCACATTCCAGTC
CGAGCTGCTCTACAACGCACTGCGGTTTGTACGCTTCGCGATGGAAGGACAGTTGCTGTTCTCTTTGACATCCGTCGATGCTTTCTCAAGGCTGATCCCA
CACGTCAGTATCTTCAGCGCACTGGCGAGTGCGTCAACCCTGATATGTCGACAAGGCAGCCGTCGGAGACACACACTCACCGCCGTAGATCCGGCGATCC
T