Description :
From Genome Similarity Track
Location :
Scaffold_16:536128- 541237
Transcript NameFunction/comments
Sapdi_VS20SDRG_06065hypothetical protein
Sapdi_VS20SDRG_06066hypothetical protein
Sapdi_VS20SDRG_06067hypothetical protein

Sequence
5109 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCACCCATATTTGATACTGCGAGATTTTGGTGAAGTGCA
TCTGGTGGCGCGTACCGCACGTCTTAAAGTTCCGTGACTAGGTAACGTTATAACTGTGTCTGGTGTTACATGCGCACTGACTCAGACCCAGAGTCGTGCG
CACCTCTGGCAGCGATTATGCTCGCTGTCCATAATCGCAGGCCACACGCCGTAGCCGCGGATTTGATTGCAAACACGAAGGTAAAGACAGTTATAACACG
CGCCACCCATCGTCGACGGCAGCACGATGACTAGACACTTCGATACATTCGCCACCAGTTGCGAGACAGCTGCGCGACGAGATTCGCAGTCGCGACCACG
TCCGATCTAATGCTCTTGTGGCGCAGAGATTGGAAGCAACTTCCGCTACCACAAAGGCTTTTGACCGCATCAGCCTTTGGACTTCCTCAGATGCTTGACA
TGACAGGCGGCGCCATGACGGGAGCGTCCTCCATCACGCAAGCCAGCTCCGAACTGATGGAAAGCGACATGCAGAGAGTGATCGATGACCGAGTAACTCA
CTGCGTTCGCAGGATCCGAGATGTGCTGAAGAACTGGCATTCGGGGGAGACCCAAATTCGAGAGACTGGAGGTCTCGCGACCATGTGCTGCTGCACGGCT
CGCAAGCGGCCAATCGGCCGGCGAGAGGGGCAGGCGCAAAGAAGACATGTGTTGACTCACGACAGCAAAACTTCAATGACAGGTTCAACGTGCCGCGTGT
CTGTGAACCTACGAATCGTCAATCGACAGGTCGCAGCACTGCTACACGCCGATGACGCAAGACCGCGGATGGATAGTGCAAGCCTTTCCGTTGTCCCTGG
TACCCATGGACGGACGCGTGCCTTCGGTTGGGTGACTTTGTAATACTGGCACCAGCAGCGTCGAGCTCACTATAGCCTAAGCAGCCATGATCACCGCCCG
AAATCAACGTGTGATCGACTATGTGAAGAGCGCCGCGCCATCAAAGTTCAAAGTGGGACGTACAATCACCAAAAATCACCCGATCCGTCGCGGCTGTCAT
CGTTCGAGTCGGTGTCTCATGGTCAATATGAATGGACAAGTGCCGACAAGTCATCAACGAACAATGCCGCACCTGGTCGACTCCAGTGCGTGGCGATCTT
GTGCGGGACACACGGGCGGGGACTCATGCGAAACCCGAGAGGGGACTGGCTAAAATCGAGCGAATCAAACGAACGCCACGTTCTCAGAACAATTTGATTC
GTCTCTTTTCAGCCAATCATAAGGCTGCGTTTTGGCGGGATGTCGATTTGTTGGAGAACTATCTGACTTGAAGATCTGGATTGCATCCTTCCGAGACGCG
TCGCACGGGGCAATTTGACACTGCTGCGTCATAGCGGCGTGCCCACTGCAGGGGGTACGAGGCAGAAACTGTCGTCTCCGGCTCTATTCCCAAGGCCACG
TGCACTTGTTGACATGCATTCTGGAATAATTTAACGTTGGGACGAGGCAGACGGTGGTATTCCAGGGGGTCTAATCAAGCAAATAAGACATTTGTTTGTA
CATAAGACATTTGTTCTTATTTCCCTTGATGGTGGTGTAGAACTCGCACGATCGCGATATCGTACGGACAGGTCGTTTCCTAGTTGAAGACAATTTTTCC
ACTCGCAGGATGTCTCCAGGTTAGCGTCGCTCGCATCAATATATATATATATATGAACGTGTTTCGCGTTATCTTCATAGTTACACAAAGACTTCGCATA
CGTAGAGACTAGCAATCTCCTTCTTCTTCATTCGCTCGCCGGTCCGTGGCTGCGTAGGCGGCGGCGCGGGGGCTCGTCTGGCTCTTCGCATCAAAATGAC
ATTTTATATTTCCTAGTGACCTCTTCGCTCGGTTGGACCAGCTCTTGTGTTGCGGGTAGCTCTAAGAATGTTCGTGGCGGACCAAGTTCGGCTGCCTGTT
GTACAGACTTGGCTTTATCTCGACGTTAAAAATAAGCTGTATTGCGCTCTTATTTGCTGCCGCCAATGACGAGTTCAAAGACTAGGATGGCCGAGAGCAC
GAGGATCGCGAGGTAGAGCCGAAAGTTGCTACTGCGCTTGGCCACGAGCTCGGCGCGGTCGCCTTCCGACTCGAGCCCGAGCGTCGCGCGGTCAATGTCC
TGGTTCATATCGTCAAGCAGTCGGTGGTGCAAGTCGGTCTCGTCCTTGATCGCAAACGAAAAGTGCTTCAAGTTCGCGACGCCCGACCCAATGATCGCGA
GTTGGTCGTCCTGGTCTGCTCCACAGTATGAGACCTCGAGCTAGCGTGCATCTCGTTACCTTGCATCATTTGGTTCTGGATGCGCAGCATTTGCGAGCCG
GCCTCGACTGTTGACGCCCTACTTAAGGCCGTGAGCATCGTGCCAGTCAAGATGGCGCCTACCCGCGCGTGCCTTGGGCGCGGCTGTTGTACGTCGTCAA
GAGCGCCGACGTCTGGCCTTCCAGCGTCTTGAGGAGGTCTTCTCGCCGCCGGATCTCTTGCGGCGTCGCGACAGCGTTGGACGTCGGGACCGCGGTCATC
GCGTCAAAGTCGCGGCGCAGCTTGGCGGCGCTCTGCTGCAGCGCGAAGACGCTCGTGCCCAGGTTCGTGGCCGCGCTCGTCCGGACCATCGAGCTCAGGC
TCTGCTGCGAGGCCCGCGCGTTCTCGAGCCGGTCCATCCAGGCGCTCCAGGCGGCCGCGCTGCTTGTCTTCGCCATGCTTCTGCTTCGCCCCAATCTGCG
TCGCAGCCGTTGCCACGCCGAGCGATTTAATAATGAAAATTAATGGCCAATACTTACATCCAGTATAAAAGGAATAAAAGAAGATCTTCCACCGTGAATT
ATATAGGGGTCGCTGGACCTTGGACTTTGTATACCTGATTGAAGTTGCCGATTTTAGTCGCCTGTTGAACCTGCGCCGCGAATACAGCTCGGTGATTGGC
TCATGTATTTTTAATTAGTGTATGGTGTATAAGCCACACTAATCATGAAACATATTATAGTGTATATTTTGGGCTTATCCGGCACGACGGGAAGTTCGAC
GACGAGCATGAGCGCAAAGCACGAAGCCCTGCATGCAGCGATCTGGGGCGGCGCCGCCACCAACGGACCAGCGCCCCTGTCGATTGGCCGCCAATACGTT
CGTCGTCGTCTACCAAGCTGGGCTAAGGCGCCTCGGTAGGTTGTTGTCGCGCTGCGCTTCATCTTGCTTGTTGCGTCGGCGGCGTATGAGAGTGCGTGGA
CAACGGACGCGGCCAAGGCAACCGGTATTGCGCTTGCGCTGTACCTCTTGGCGTTCCTTCTCTTTGCGCGACGCCAGCTACCACTCGTACCACGCGCTTC
TCTATGCAGCTTGGCACAACGGACTGTCTGTAGTACATTCGGCTGGTCTTCTTCCTCACACTGCTCAGCGCGTTCGCCGACGTGGGCCGCCCGCTTGTGC
AGTTGCGAGGTCGAGAGCCCATGGACTGGCCTCAAGCGACCTTGTTCGCTGCGACGCTCTCTGTTGCCTGTGCCAGTGTTGGCATCAACGTACGTACTTG
TAGCAACAACCCATCGAGCATCCTGCCTGTTTCTAGATCCACATCTTGTACCAAGTGGTACAGCAGTCGTTTACCAACAAACAACGTCGCAAGCTGGCCA
AGAAGCAGTCGTAGCTGTGTGCTGTAGCCGCCGTCAACGACCACTCTCTGGACTTGTCCTCGATGGTGTGGCCCCCCGCGCCCCTCCACGTTGTACACGA
CAACATTATCGTTGAGATATGGAGATAGAGTCATATTAGAAAGCTGACGTTCAAAGGCGCAAGGTTGTAAATGCGTGTCACGGCTAGTGCCTCTTGCTGC
ACGATGTAC