Description :
From Genome Similarity Track
Location :
scaffold_63:53611- 54859
Transcript NameFunction/comments
g2510.t1hypothetical protein

Sequence
1248 bases(100 bases per row)
GTCAACGAGGAGAACCGCATTTACGGCGGTTCCGAGGCCAACATCGACGATTACCCGTACATCGCAAGCCTCCGCTTCGAATTGCTGGACGACACCTTCT
GCGGTGGCACTCTGATCGCCCCGCAGTACATTCTGACCGCTGGCCACTGCATTAAGACGGAGGAAAACACTATCATCGCCCACCTAGGCACGGAGTTCGG
TTCGGGATCTGGAACGGGCGAGTCGATTAAGGTGGTGGAGGGGTACCAGCACCCTCTGTACAACCAGAAGAAGCACCTTTACGATGTCGGTCTGCTGAAG
CTCGAGAAGGCATCGACGCAGAAGACCGCGACATTGTGTGCCGCAGACGGCTCTGACAATCCGGTCGGCACTAAGGCGACGGTGCTGGGATGGGGACTGA
CCGAATCTGGATCGGAGAGCCACGCGCTGCAGGAGGTGAACGTAGCTGTGATTTCCAACGCGGAATGTAACAAGCAGTACGACAACCGCATCACAGAAGG
CATGATGTGCGCTGGCAACGGCGGAGGCAAAGACTCGTGCAACGGAGACTCGGGTGGCCCCTTGGTCACTAGCGACGACACGCTTATTGGTTTCGTGAGT
TGGGGCGGCAAGTGCGGCGTCCACGCTGGTGTATACACTCGACTACCGTTCGTCATGGATTACATCAACGATATTCTCAACGGCGGTACTGGCAGTAACT
TCACGGACAGCACGGCGTCGTCCGGATCAACTACGCAGCAGACTTCACTCGCTTCGTCAACGGCGGGATCAGCCGATACGCCGAGTGTGGCCAGCTCCAG
CTCGGGGGTATCAACCACGCAGTCTTCTACTGCCGGTTCGACGACTACTCAATCCTCCACTGCCGGCTCCAGCTCAGGTTCTCCGACTGGTACGTCTGCC
TCGTCAGCAACGGAGAGTTCTGGTTCTTCTGCTACTCCGACTGAAACCACGGACGCTCCTGCAGTAACCCCAGCGGCTACTACCAGCTCTGATACCGGTG
GTTCTACTGATGCTTCCACGACTGAGGCTTCTACGGGCACCGGTTCTACTACGGAGAGCTCCAACGACTCATCTGTGACGCAGACAGCAACGACGGATGC
TCCTGCATCGACCCCTGCGGCTACTACGGGCACCGACGTTGGTGGATCGACTGGTTCTTCCTCGACTGGTGAATCGCTCTTATCGTCGGGCACCGGTTCG
ACTACAGAGGGCTCAAGCTCTGCAACGCCGGACGCTCCTGCAGTGACT