Description :
From Genome Similarity Track
Location :
Scaffold_220:5360- 6716
Sequence
1356 bases(100 bases per row)
GCGCCCATTCTGGCGCTCCCTGACTTCGGGCGTCCATTTTCGGTTGTGTGCGACGCATCCAAATTCGCAATTGGATGTAGTCTGATGCAGGCCGACGCGG
ACGGGCGCGCTCGTCCCGTGTCATATCAAAGCCGCCAACTCCTTCCGGCGGAACGCTCATACCCCGTTCATGACCCCGAACTTCTGTCGATGAAGTTCGC
TCTCACCAAATTCCGCATCTACCTCCTTGGCAGCAAGCCCTTCGTGATCTATACAGATCACGCCTCCCTCCGCACGGCAATCAACTTGCCGCATCTCTCG
CAGCGATTGGAACGATGGCTTTCGTTCTTTGCTGAATTCACCTTCACCGTCCAATACAAACCTGGCAAGGACAACATCCTTGCCGACGCCCTCTCTCGGC
GTCCCGACCTCGCCCTTAACACGATCGGGTTCCTCCATTCCGACCTCCAAAACCGCATCCGCGCGGTTTACGCCTCGGACCCCACGTGTTCTGCGCTTTT
GTCCGGATTAACGGCGCCTGTCTCTTCAAAGCCAAGCCGTTCCCAGTCACTACTCCATCGCTATTTCATCCGTGATGGTCTCCTGTATTTCACCCCTTCC
CGCGGCGACGAACCTCGAATCGTCGTACCAAGCGACGCGCCATTACGCGCTGCTATTCTCCGGTCCTTCCACGACTCCCCCAGCGGTGGCCATTTCGGCC
GCGACAAGATGTTCCACGCGGTCGCGCGTTCATACTGGTGGCCGCGTCTCTACAAGTCGGTGGTTCACTACGTCGCTCGATGCGACGCATGTCAACGCAC
CAAGATCACCGCGGCCTCCAAAGCGCCGCTCCAACCTCTCCCGACACCCGACGAACTTTGGTCGTACATCAGTATGGACTTCATGTTTGGCCTCCCACGC
GACGTGTGTGTCGATCGCGCCTCCAAGTACGTGGTGCCTGTCAAGGACTCGGTCAGCGGCCACGACGCCGCCCGCCTCTTCTTTGACAACGTCTTTTGTC
GCTTCGGCCTCCCACGATCCATCGTCTCTGATCGAGACCCCCGTTTCACTGCCCACTTCTGGTCGACGCTCTTCGACCTCTGCGACACCGATCTTGCCAT
GTCCACCTCCGACCACCCCGAGTCGGACGGCCAAACGGAGCCCGCAAACCGTGTCCTGGAGGACATTCTGCGCTCCTATTCCGTCCGTCAGTCCTCCACG
TGAAGTACGCTCTTACCCCACGCAGTATTTGCATACAACGCCTCCGTTCAGGCGTCAACCGGGTTCTCGCCACATTATGCGGTCCACTTGCAGCACCCCC
GGCTGCCTCAACTCTTAGACAGTCCCCGTTTGAGTGGGGGAGGGATCCAAATCAAC