Description :
From Genome Similarity Track
Location :
Scaffold_2826:536- 2730
Sequence
2194 bases(100 bases per row)
TCGACTAAATGTGGCCGGTCTACGGGCCAAGTTGAAGATCAAGGATGGGGGATCCAAGGTACTGCGGGATCACGTGGATCATTTCATCGAGACGTTGGGA
GACGTGGATCTGGCCGACAGGCTGACCCTGTTACGACTTCCCGACGCAGACGAGCTTGAGGAAGTGCTGCGGGTGGTGGATCGCGCGAAACACCGCCAGA
AGAAGGCGGCGGTCGGATCTGGCAAGTATCGCCAAAAGGCTCCGACGCCTACGGCCCCAGCTCGACGTGTCCACCAAGTCACGGCGCCCGACTCAGGAAC
TGAATCAGGATCCGACGGTTCGGACTCCGACCCTGAAGATTACCGTCGGGTCTGTCTCACTGCATCCAACGATCGAACGGCGAAGACAGGAGACAACTCT
CGACCGGGGGATACCGTACCCGGGGACCGTGGGATGTACAGATCCCGAGATCTCATGGATGAGGCAGCACAAGTCAGGTGTTCACAGTGCGGATCCCGGA
AGCACACTGAATCTGGATGCTGGAAACATCTGGTCTGTGAGAAGTGTGGCAAGAAAGGTCATCCCGGGGATCATTGCTTCTACGTGTGTCGCGGGTGTGG
CGAGATTCACGACGTCGGCAAGTGCCCGATGGAAGAATTCTACAACCAGATCCGCCAATGGTTTTGATCCAGCCCAGGCACCGAGGGATGTTGCCAGAAG
TGCGCCGAGAAGATGTTAAACTAGGACGCTCGCCGGCTTTGAATCCGGTACGAGCCGAGCGTTCTAGGGTATTGCATTTATGCATTTGTGAACAAGACAT
CGCTAGATCCAGGTAGCAGGACCCTAGATCCAGTCGATAATACACGTGATCTACATGAAGTGTCAGTTGCCAAGATCTCTAGTTTGCGCCAAGTGGATGA
GTTTGCCAGATCCGAAGTCTCGTCAACCCTGGATCTACAAAGGGGAGAGGCACGTGGTTATTGGGAGAAGCGCCAACATGGCCGATGGTTTGAGCCTACC
AAGGGTGAGGTCACTGCAGATCCACCTAAGGTCTGTCAGGTCACTGGATCCCGTGGATCTGAGGATGCATGGATCTGCTAACAGCAGAGTCCCGTGGGTA
CTGGAAGTACCATGCCCCGCGAAAGTGGTTCAGACAAGCCAAGGTAGGGGGCAAGATCAACAATGAAAAAGCAATCCTACTTCTAGATAGTGGTGCCGAG
GTGTCTATACTAGATACCGCCTTTGCTCGTAAGGTTGGGTGCCAAGTGGATGGGAGTCGGATCCAAGACTGTGTTGGGATTGGTGAAGTCGTGTACCGTA
CGAATGGGAGAACGCGGATCAAGATCACGCTGGCAGGTTGTTTGGTGTATTGGTTTGACATTTGGGTTGGAGATCTCGCTGGTCAAGACGCCATCCTCGG
GATGGATTTCATGGTACCGGCCGGAGTGAGGTTTGGATCTAGCGGATGGGACACTTTTGTTTCCCTGACGAGATACGAATCCAGCTCAGCGGACGGCGAC
CGTTGTATGGAGCGAAGATGAGGATTATAAGGGCGAATAAGACGACCTGGATCGAGCCCGGAGAAACCTGGGAACTGCCAGATCGGTTGAAGTGGGTGGA
ACATGAGAAACTGTGGGTCACTCGGGGCAAGAAATGGGTACCTAGAGTAATCCAAGGACCAGGTCGATCACAATTATTGAGGGTTGCTGGTCTTGGTACT
GTGTACCACCTGTACCCATTAACCGGTCAACCTGAACCGGTCCACTACGATCCCGCTGTGATTATGGTAAGTTGTTTATGCCACCCATGATTGGACGAGT
ACAGAATGATTGGATGAGTAGAATGATTGGATGACCTAGGTAGTGAGGACTGTGTAAGCCCCGATCAATCAATCACTTTCGAATCTTCCTTCTTCCGCTC
CAGTGTCTTTACTCCGGTCCCCGCACCAAGCGCAGAAGTCACTCCGTTCAGCCCAAGCTTCGTCCCAACTCCTCTACACCATTAACAGGTTATGAGCCCA
AGCACCGTGTCCTTTGCCCATGACGCCTCAGCCAAGGTCACCATCGACAAGTTCAACGGTGACAACTACGCGACGTGGAACCGCTACATGCGTGGCGTGT
CTCTGACCAAGTCGGTATGGCACGTAGTGAACCGGGAAACGACGCCGAGCTTCACGGATATCCGGACCAAGGACGACTACGTCAACGCGAGCAA