Description :
From Genome Similarity Track
Location :
Scaffold_943:536- 2035
Sequence
1499 bases(100 bases per row)
CCGAGGCGTCAGTGCATTGCTTTAGCCACGCTGCCGTATAGGATAGGCCGACGACAAGGAAGACGTCAAAACACACTTCGTGGAGGGACGCATAAGCTAA
TAATGCGGCTGCTCGGTGACCACAAGGGGACAAACCATTCAGAAATGACGCTGTCACCACCATGTATTCATATTGACCATCATTCATCTAATCTTAAAAA
AAGTATACGTCTTTGTCCGAATTATTTTGACCATACGCCAAAACCTGCAGTTGTATGGAAGGCTATCGAAAGCCTCCAAATTTGCAAATGTTAGTTATTC
GCTGCTGTGATTGGTTTATCGTAGGATCAAAAACTATTGCGACTTTTCGGACGTCCGAATAATTATTGCCAGGACTTTAGTAGGTACGCTATTTTGTGAG
CTATGGTGTAAGTTTAAGACTTTTGACCTTTGGTCATTCGGCACATGCATGCACATATGGCACGACGCGTGCCATATATATCATCATTTTGCAGTGTAAT
TTGAGTTGCCGATTTAACTACTAGGTGAGAGAAGTGATTCTATTCAACCCCAACAGCCTCCAACTTCAGAACCAAAAATAGGACCAAAAGTTAGCAGGTC
CGCTTGCCATCAAATTTGATAGATAGGAGTCATCGAAGATATTGAAGCAGACATACCTCTTAGATCTACTCTTCGGTGCCGCCACTGCATTCTCAGGTAT
CCTCAACGTAGCTGAATTGCAGCcgcaaaaaaaaataatGCCAGATTACAAATGCTGCTTTGTCCTTAGAATAAGGTGTTGTCCTGAACGTAGACTTCAA
GTTGGTAAGGAAGGCCCCCTTTGGGCTTGTTTTGAGCAAAGCTTCATTCTAATAAGGTATAGGTTAAATCAGACAGCTGTTAAATAAAGCCCTTCATCTA
TGTTTCTGTAAAATCGTAGATACGAGACAAAAAACTCGAGCGATAAGGGGTTACGTTACGTAATTTTTAAAAAGCTACATGTACCAACGAGCCGGTGTTC
TGTGAAGGCGACTAGATACCGATTTTTACTTTTTTTACCAGCGTTGTTGATATTACGTTGTCGTAATCAGACTGATTAAGCCAGCTCTGTTGTCGACGAC
TTAATTCGTTTAAATCGCCCTGTGCCAGGGCCGAGCTCTTTCTCGACATCGTACGCACAGcgagcagcatttgctgaGGTAGTGATACCGCAATATGGCT
TCAGCTAGGTGAATACAGCACTAAACTATCACTAGCATACTGACCCAATATTCCAATAGTCGCTACACAAGAAAGCAAGTGGCCACGTTGCGCTCGTCTT
ATCTGGATCATGGCCGAGCAACTTTCCCCGTAGGTGCACTACAGTATGTCACGAGCATCGATTNCATGCGATGCAATGTACACCATCTGCCAGACACCGG
CATTCCCATCGCCTGGGGATGGACAAAGTTCTGATACACGTACATATACGGACGGAAGACTTGCAACACATCACAACACTTGAACACGACGGagacttc