Description :
From Genome Similarity Track
Location :
Scaffold_1:5359824- 5360977
Transcript NameFunction/comments
Physo_258317ATP-binding Cassette (ABC) Superfamily

Sequence
1153 bases(100 bases per row)
TTGTCTAAGCTTACTGCTCGCCCGGGTGAAGACCAAGCCAGCCAGGCGACGGCTTGCCCTGCACTTCGCCGATGTACAGCGAGAACTTCTGGCGCCACTC
CTCCGCCGCGGCACGGTCCTCCATGAACTTGGCAAAGGCAGCCATGTTGGCTTCTGGGATATCCCAGGGCTTGTTGGTGTTGATGTCCGTACGCGGGCTG
TTGGACACCAGGGTCGTCTGTGCCTCCTCGGAGATGATCCAGTTCATGAACAGCTTGGCGGCGGCAGGGTGTTTCGCCTTGGACAGAATCCCCATACGTT
GACCCCAGCCGAGGTACTCAGTGCCGTTGGTGACGAAAGTCAGCGAGTTGCCACGCACACTGCAACCCACGCCGATAGCCTTCTCACCGGAGGTTACCAG
GTCACGGGCAACGTTCGTTCCCCGGTTAAAGCTGGCATTTTGCTGGACGAGCTTGGAGACCCAGTCCCAGCCGTACTTCTCCACATAGCGGGTAAACAGG
AACAGCACGGCATCGTCGTCGTTCGGGTAGGACGAGGCGATCTTGCCAACGTACTTGGGGTCCACCAGGTCGGCCGGAGTAGCGGGCGGCTCCAAGCCAT
TGAGAGTGGTCGTGTTGTACACGAAGCTGAACTGGTAGATCGAGTACCCCAGCCACGCGCCGTTCTTGTCTCTCAGCGAGTTGTGGATCTTAGAAAAGTT
GGCCGGCTTGTACGGGAGCAGGTCACCGGTCTTCGCCCACCGCGTGAAATCCTGCAGGGTCTGCAGCGCGACTACGTCAGGCACCAGTGTGTCGGTCTCC
AACTGGTTATCGATACGCACGTCGTGGTACTTGCTGTAGTCGACGACAGCGGTGAAGTTCATCTTCGGGAAGCGCTTCACGAAGGCGTCGTGAAGAGTGT
CCTGCGAAGTAGCAGTGTCGCCACCATGGTACAGAACAAGGTTGCCGCTTTCGGTGACAGCGTCCGCGTAAAGCTGGTCAATGGTCTTGGTCTCTTCACC
GGAGTTGGACTTCGCGACAGCGTCAGACGAAAGCAGGGCAAAGACGACAAGCAGTGGAGCAAAGAACTTCATGGCCGGTGGTTCTCGAGGCCGAAAGGTG
GCGCTGGGTATTGAACGACTTGGTGCCGAGGCAGTGAATTTGAGAATGAAACT