Description :
From Genome Similarity Track
Location :
Scaffold_30:53595- 56235
Transcript NameFunction/comments
Physo_134104hypothetical protein

Sequence
2640 bases(100 bases per row)
CACGAATCAAACGAACAAATAGAACTTTCGTGATGAAATGCTGCCGCATGCTGCTCAGCATCCCCCACACTCTGAAATTTGCTAATTGTATGTTGGGCAG
GAAATGCTGCCCATGATCCATGCTACTTCATCTACTGGAATGGCACGCTGTTCTGCGCGAAATATGACTGCAGTGCCGTCAGCGTCGCAGGTGTCGGCAG
TTTTGTCTGAGCATACGCCAAATGCTGAAAACACAACAAAATAATCGTCAGAGATGATACATCCCCACCCCAGCGCATTGAATGAGCAAAAAAACAACTT
ACCACGCCAGGCTTAGAGGCCGACAACTTCGCAATTGACTCGGCAAGGTAGCGCGTTGGCACCGGGTACTCCTGTAGGTGGTCAAGCGGCACCACAGACG
CGAAGAAAAGCTTTGCGTAACCAGCTTCGTATCCCGTCTGTTCCAGTTCCAGCAGCGCTTCATCCTCGTCCTTGACTGCAGCACCGCTTTCTCCAGCTTC
CTCGAGAACCTTTACCACTGCGGCCAACATTTCTGTCCACAGATCCAGGTCCGCCACACAAAGCTCCGTTTCACACATCAAGCGCGTCAGGCCAATAACA
CAGGCCTTTCGCTCAGCAGGGGTACGACCGCGAGCGTTGCACGTCAGCCAGACAGACTTGATAAACATGGTCGACATTCCCTTCTGAAGAGCTTCCAGAG
ATGCCAAAAATGTGTCTGGGCCCAGCTTTCCGATCAGCACAGAGACCGTGTAGATCAGTTCCTTCGTGTATCCCACAGAGTTGCGGCCAGCCATACGAGT
CTGCAACCGAATCATGAGGATTTTGACGATTTCGTTCAGGAAGTTCGCGTACGCTTCACGGGCCATGAACGCGAAAAGACCGCGGAGCAACGAAAAAGCG
TTCGCTTCAGTAGACCTGGACGAAATGAGCTTCTGGAAAACACCAAGAATTCCCTGCACCGACTGAGCAACATCATTCGGGGCCTTGCGCATGTACGCCT
CAATGAGCTTCACAATAGCCGGAACGTTGCTTACACGCTCCCACAGCGTAGGGTTCAGTAGCACCGGGAACATACTCTTGTACGCATCGGAGACGCCGCT
CGGTCGGAGTTCGAGCATCTGTGCCAGCACCTGATACACGTAAGGCGACAGTGCATCGACGTCGTTTGTCAGCACCTTCTGGAACGGCGGGAAGAGCAGT
TCCTCGAAACGCTCCGTCGCGGCTGGGTTGGTTTTGCAGACGTTCAGGATCATGACGGACAGCGACTCGAAAAGGTAGTGGCTGAACGACGGGTTGCTGG
GGTTGGCGCAGATACGGTTCAGGATACTGGTGAGCTTGTTCACAGCCATATCTGTAAGCGGCAAAATGTCCTCCTTGGCCACGTTCATCACCCGCATAAT
CACCTTCATGAGGTAGTCGTTTTCCGGGTAGTTGGGCTGCTCAAGGATGTTAAATACGTGCTCCAGCAGCTTGCCTAGGTACGGGGCAAGACGCTCCTTC
GAGAATCTCAGCGAGCCGGACGGGTCCTTCACGGTAAGAAGGCGCTCGAGGCAAGCAGCAGCGTAGGTGTGCACCACAAACTGCGACGGGTCCATGCAGT
TCATCAACAGAGGGAAGAGCTGGTCCATGACTTCCACCGGCATCTGACTACGGAATGTCGAGACAAACTTGATGGCATCGGCCTTCAAGATGAGCGATGC
CTGATTGGGAGTCGACAGTTCTGGAAGCACCTCCGCCATGAAAAAGTCCATCAGCGGCACCCGGCTGTTCACCTCAGATACACCACGCAGGCGCGACTGC
TTCATCGCGGAAATAGCAATCACCAGGTTGATCGACACGTCTTTCATCGCCCAATTCCGAGCCGGGTCGGCCTTGTACTGCTGGAGGTGGGTTTGGATCG
TACTCATACAGATTTGCGTCACAGCCTCGTCAAAGTTGCCAAGCAGGCCACGCACCAAGTCGCGCGCGGCGCTGCGGCGGCTGTCACCGTCAGAGCCCTC
AATATCGCGGCGGATGTAGTCCATTGGGTTGTCCTCGAATAGCTCCTCATCCGACGACCGCAGCTGCAGGTTCTTGACCACGATTCCGCACAGCTCCGAG
AGCACCTGCGGCGACTCAAACAGCGCGCGGTGGAACGAACGCGAGGCCACCGACGTCAGGAACTTCATGCATTTGGCGGCCGGCTCGTCGTGCTTGGGGA
AGAGCGTGATGCGGTTAGCCAGAAGGTTCCAAATCACCTCGGTAAACTTCTGCAAGAAGGGCTTGAACTCCTCGTCGTACTTCTCGGCATACAGGTTAAT
GTTCTCAACGATCGCCACCAGGAGCCTGTCGATCGGACCGGGCTCGTCCTCATTGTCCGTGTCCACCAGCGCCGGGTTCTCGTAGCTGAAGTAGCTCAAG
AACTCGCCCATCCACTCGGAGATGTGGTCCTCGAAGTACTCAGGCAGGTCCTGCCAGTTGAGCGAGTAGAAGATGCGGCTCATGTACCGCAGCGCCGCCA
TCATGAGCGCCTGCTGCTCGGTCGCAACTCCCGGCGCACGCAGCGCGACGCCCGTCTCCTTGAAGAAGACGAGCAGCGGCTCCTGGAAGGCCTCGAGACA
GTGCTTGAGCTCGCGGAACAGGTCGTCGGACTTGAAGACG