Description :
From Genome Similarity Track
Location :
scaffold_179:5359- 6572
Transcript NameFunction/comments
g5186.t1 actin-like protein

Sequence
1213 bases(100 bases per row)
AACCATCAGAGTAAGTTGATTGTATCTTGCTGCTATTGATTCGCTGTATGTTGACATTTATGCTTTTTTTATTGGTTTTTTTTTTCAGCCCAATCCTCGC
TGCCTGGCAAGGATGCTGCGCTTTAGCAGAATCGAACGAGTTTTCTCAACGTCTTGTAACCAAGAAAGAGTACGAAGAGCACGGTAGCAACATCTGCTTG
AAGCGCTTCTAACAGGTAAATATAAACTGACGGGTACCAGGAATGTATTTTTTCACTCGACAGAATGATGGTAAAATCACCAACGTGGGCTTGAAGTCGA
TCCTCTCACTTCCCAATCGACCACTTCGAGTTCACTGTTCACCATGAACTCCCAACTACGTCGCTGTATCGGCAAGAGCGTCATCCAGACGCAACAGCGC
TCGATGAGTTTTAAAGTGCGTGTTGGAGGCTTCGAGGCCCCAAAAGCCCCAATCTCCGAACGTCAACGTGTACAGCATACGTGGTGTTTATCTGGAGATA
AAACACTGGAGAAACTACGCGTAGCCACCCCTGGTCTCACTTATATCTCGGTGGCTCCTCCGTCGTTCTTCGACGAGATGGCTCAAGCTCAAGGTACCAG
CAGTAACCAGCTTTCAGTGGTGGCTCGAGTCTCCAGCGACGCCCAGAGTCTACTCGAACGTGTCGATGTTCTAACTCGAGGATCCAACCGCCTTCTAATT
GGATTCGACCCTCGTCCACCTCGTGGGTGGCCTGTTGAAGACGCCGGAGAGCCTGGAAAACATCTACTGACTGAAATCTTCGTACGTGAAGCATCCGAGC
TCCGTAACGTTGGTGCTTTTGGTGGTGGGTCTCTGGTAGTGACTGACAGTGAACAAGGAAGTGTTCTCGTGAACGATCGACCGTATGGGAAGCTCAAGCT
GGCGGCTTTCGGTAGTCGAGTGTTTGTGAACCAGGAACATAAATTTCGTCTTGGTAGAGTCTCCTTATTCGCTGGTAGAGGCGGTCAGATCTACCTGTCA
GCTCCGGAAATCTTTGCTAAGGATCGTATTCGTGCGGCGGCAGGACGTTGGGGAGAATCAAAGATTCTCATTCAAACGCCAACGCTCTCCACTCCAAGTC
TCGGAGCAGCAGCGACTGGATCTGGTAGAATCCGCTTCACTTCTACCACGGATGAAATCGACTGTCGATGTGAGAAACAGACGCTGGTCATTGCAGGCAA
TGGGAGCATTGAC