Description :
From Genome Similarity Track
Location :
Scaffold_620:5357- 6826
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_620-snap-gene-0.11Isoform 4 of Protein CLEC16A

Sequence
1469 bases(100 bases per row)
ACTGTGCTGCTGGAGACAGAGACGTCGCGCTCGTGTACAGCGTCGTTGACTTGCGGCCGCCGCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGTGCCTGAACGCGACGAACTG
GCTCAGGTTGTCCGGCTCGTACTGCTCGTCCACGAGCTCTCGGAGCTTGCGCAGCGTGAGGAAGACGCGCATACTCTTGCGACAGACCTCCATCTCGTTC
GCGGGGCTGCGCAGGTTCAGCGTGCCCTTGCGGTCCGCGACAAAGTCGATGACCGGCGGGATGAGGAATTCGAAGGGCGACGAGCTCTTGAAGTTGAGAT
TTGCTGGGAATTTTGTGCGCTGGAACGCGTCAAACTCGTCCTCGAGCACGTAGATGAACAGGTCCACGTCCGCCATGGCGCCGCGCATGCTCTCCATCAC
CTGGTGCGTGGACACCGAGTGGATGTCTTTTAGGACCGCGGCGTGGCGTGGCAGCAGCCAGTGAGTCAAGTCGTTGCGCTGAGGCTCGAGCATCATGTCC
ACGAGCAGCCGAGCCGCGAGCTGCGTACAGAGAAGCCGCGTGTCGGGGTTCCGCGCCAGGATCGACAGGACCAGATCCATGAGCCAATGTGGGTACTGGC
CCACGTACGCCTCGACGCTGTGTGTGGACGACGCCGAGTCGGACAGTCTCTCCGGTGCTGTTGTTTCAAAGACAGGTAGAGACTTGATCTCGTCGCCGTC
GTTGCTAGTCGTCGTTGTGCCATCTCCACTGGCATCTCCATTGCTTCCTTCTTCACTCTGGTCGTCCTCGTCTTCTAGTTGAGACGTTGACGAGACGGAG
AGACCGGAAGAGGACGTAGACGACACGACGCTGCTGCTCTCTAGTTGCTGCTGGTCCTCGGTAGCGTCTCCCTCTGTTTCTTCATCCGCACCATTGTCGT
CACTCTGCCTCAGCGGCTCTGTCCCCATGGTGATCCCCAGCCCGCGTCGGTGCTTGCGATGACGGAAGGGAAGCAGGTCCAGCTCACGCAGCAGCGTGTG
GTCGATCGCGTCGTTGTTCACGACCGCAAGGATGAGCAGCAGCGCCGCCGACGCGAGCAGCTCGTCGCTCGAGGAGATGAGCGCGAGCAGCGACTGGCGG
AAGCAGTTGGACTGGCTGAGCACGAACGCCTCGACTTCGTGCAGCGGCCATTCGCCCTCACTGAAGCGCGTCTGCAGGTAGCAGAGCGGCGAGTCGCACT
TCTCCTGTGAGTGGGCCATGAACACGTGCGATTTCTTCTTCAAGCCCTTGCGTTTGGCTACTGCTGCTG