Description :
From Genome Similarity Track
Location :
Scaffold_170:53555- 54668
Sequence
1113 bases(100 bases per row)
GGGCACCGAAGGAGCAAAATACGCACGGCTGAACCCTGTCATATACTTCGAAGTAGTTTCTACCCGAACAACTACTCGCAACTTTACCGAGCTTTCTGTG
ATATCGGCTTGCCTCAATACTCTGATCACCCATCGACATCATCGTATCGTATGCAGATATCTGATGGACTCATCTCCGGAAAGCTTAATTACTTCCATCC
TCGCATACAGCTGAACTATAACTTATCTCTATGATGAACGCTTTACCTCCCTTGCTGACAGTGATCCATTGTCGAGGATACGGGTTAATGATTTCATTAC
CGATAGACTAGAACAGAGCCCCCCCCCTTTTTTTTATGTCTAACCAATGGCCCTTGGTGCTTACGATGGTTTCGTTTCTCAGTATTGACATTACTTAGAT
GTAGCTAACGACGTCCAACAGAAACCACGCTATCGCCCGTTTCTTACGTTCGTTCTCGTGAATGAATTCACTGACTAGAACCTGTCGGATGAAACCAAGG
CTCTCATTCTTTAATTCACCGACTCGGTTCAGCTCCCTACGTCTCTGTCCACCAGCAGCTAATGATCTGCACCAACAGCCTACATCATGAGCCTCGTGAC
GATCTTGGTTATCGCTACCGTAGGACGTCATCTGGCCTCGGAGGGTCGTCAGCCAACCCAAATGAAAAGCTATCGGAAGCAAAGGATCCTGGTGAGTGGA
AGAAACGATCGACCCCGCCGTACGGGCGTACGCCGACGAAGCCGACGTAACAAGTGCAGCCGACGTCATTCGCGTAACACGCAGCGCTACCCACCCTGGA
CTCCTGTCCTACATCGATTTCAACTTCTACGACAAACAGTGTGGAATGGTGTTGCAGCTACGCTGTTTGAAGAAGAAAAAAAAATGAAGTTGACTAAATG
GGACGCTACGCTGTTAGAGATATCCAATTCCACATGTTTTTGCGTTGCTAACAAATAAATGTTGCTGTTTTCAAGAAACTCAGGTTGTTGTAGCAAACCC
ACATACAAACACGCCTACTACTGAAAGATGTCATTCCAGCGGCCCAGGTTTCCTTGATAACCGTGTCGGTCGCGAACGTTGCCTTTACTGTCAAACAGCA
CGCATGCCATCTC