Description :
From Genome Similarity Track
Location :
Scaffold_349:5355- 7207
Sequence
1852 bases(100 bases per row)
CGCCGGGCCCGTCAGTAGATCAGCAAAGGTCAGGCACTTCTCTTCGTCCGTAGCCTGATCTCGCAGGAACGCCGACTTTACGTTGCTGATCCACGATCGG
GCGCGGTCTTCGTCCTGATCCTTGCCACCGAACTCCTTAAGATCGGACATCGCCGAAATCCGCACACGCTGGATCAATGATGACCCAGTGGATCATGAGG
CAGCGGTGGCCACCGCAGCAGGGGCCGAACTCGGTAGATCAATGTCGTCCGGATCGTATTCACACTGAGAGAGATCTTGATCCGGCGATCCGGCTGATTC
CACCTCCACGTCCCGCGATCTAACGTTGTCGTCGACCACTGGAGTAGGTGTTACCACCGTGGCCTGTTGTTCCTTCAGAAATCGAGCCATCGCAGCCTGA
AAGTAAGACTCCAGTTTGCCATTCGACTCATCTGATCCGGTAGCACTGGTGGTCCGATCGGTCGACTTGGGTTTCTGCTTCCGAGGTCCTGATCGCATGC
GTTCCTGACGTTGACTCCGTGATCGTGCGTCCAACATCGCAGATCCTGAAGGGTCGAGGGACATCCGTTGAGGTTCAGACGACGTATCCGATACGTGTTC
CGCTGCGGAGACATAAGGAGACGACGGTCGGTACCCAGTGGACTCCACTCGCGGCGATGACACTGGAGCCGGCGACACTAGATCTGGCACCTTCGGGTCC
GGACTGTCCGCGATCACGTCGACCAAAGGTCTCAACTTGTCGACCAATGTCTGGATCACATCGAGATCTTGATCGAAAAGATCGTTCGCTTCAAAGGCGC
CAGCCACGAAGCCAGCTTCCTTCAACAGCCCGAGCAGGTTCTTCACTGCCATCAGCTTGTTGTCCGTCACTCGGGGGGCCGAGATCGGGCCTTTCGGGTC
GTCGATCTGCTCTGGCCGCACGATCACCATGACAGGATCTTGACGCAAGAAGTCTCGCAGTTCCTTCAAGTGATACTGACGATCCAGGTCAGCCTCGGAC
CAGTCGAGCGCCGACGGTCTGGGATCTTCGTCGTCCAAGCCTGGCGTCTCTCAGCTTCTTCCTCACGATCTGGGCCTTGTCCGCGATCGCGTCCAGGTAG
TCCGGATCGAGCCTGCTCGGCGAGTCAGCGAACGCGTATCGGTCCGATCCCGCCTTAGTTTGTTTTGTTAGTGAATCTCGGCTCGCACCAAGCTCCACCG
GGGTCCCCGAAGGAACCTGGGGAGGGTGTTGAGGTTTGTCGTCTAGATCTGTCTCCTGAACGCCCTCGATTCCGTCGACAGAAGTCCTCCGAGCACTCTG
TCGATCCGCGGATCTCGTTTTGTTCAGCAGCGTCTTCGTCGATCCGATATCCGACAACACCTCTTCCCCTGGTTCTTTCTTCACTTGCGCATCTTCTACG
GACTCACGGTGAAATCCGGAGTCCCCAAGAGATCCGGGCACGCGCACCATTGTGGTGTAGCGGGATCGGCCAAAATCTGGTTAAGGCCTGATCGGGCTTC
CCACGAGCGCCCAGACACCGACTAACGGAGGGGGTTCCCCAACGATCCGTGATCGGCTGAACTTGTTCTCACCTTGTGTACCCGTCGGCGGGCTGGATCT
GCTCTCTCGGGGCTCCGAAGATGCAGCACTTGGTGAAGATCGAGTGTCTTGGCGTGACGCGGGGATAGTTTGTGGAGCAGCGCGGTAGGCTTCGCTCTAC
GTCCGAGTATACGCTCCGATCGAGGATTGTTCGCTGCGATCGGTCGGCCTGGAGTTGATCCAAGGCCTGTAGTTGCCTTTCCGGGTGTGTTCTTTCCTTT
CCTGAGCTGCTTGGCGCTTCCTATAGCGGGATCGAGGTTGATCGAGAGGAGA