Description :
From Genome Similarity Track
Location :
Scaffold_232:5355- 7042
Transcript NameFunction/comments
Phypa_INRA-310PPTG_19942amino Acid-Polyamine-Organocation (APC) family

Sequence
1687 bases(100 bases per row)
TGTGGCGGACCAAGCCCTTATCGGTAATTCAGGCAGAGGAGATGAAGGAGGACATCCCGCGCACACTCAATCTCTTCGATCTCTGCTGTATTGGTATTGG
CGGTACCATTGGTAGCGGTATCTTTTCCACCGCCGGCTCCATCATCTCGGAGACAGCCGGTCCCGCTGCCGTCGTTAGTTGGCTTATCGGTGGCGTTATT
TGCTGTCTCAATGCGCTCGCGTACATGGAGTTGTCTACCCGCGTTCCGTCCTCTGGAAGTACATACGCATACGCCTACCACACGATTGGAGAGCTTCCTG
CTGTCGTCGCCGCGTGGCTGCTGACTCTCGAGTACGCTGTGTCTGGTGCGGGTGTGGCGCGTAGCTGGGGAGACAAGGTGGAGGAATGGCTACTGATCGA
GCACCCGGACAAGAGCTTCCACTGGCTCAACCTGCAGTCTGCCAATCTCAGCGGTGGTCTCATCCAGTTCCTGAGTATGGTGGTGCTGTTAATGGGCGTC
CGATTTGGCAAAGCCTTCGTGAACACCGTCACGATGGTCAAGATGGCTGTCGTGGCCTTCATCATCATTGCCGGCTTCGCTGCCATGAACCCGGACAACC
TGTCCCCGTTCGTCCCTACACGCTCTGAGCTTGATGGCACCATGACGTTCGGAACGCAAGGCATCATCACCGGCGCTTCACAGGCGTTCTTCGGCTACGT
TGGTTTCGATGAGATTTGCTGTCTCGCAGGAGAGGCCAAGAACCCAAAGAAGATCATGCCGATTGCAGTCATGTCCGTTGTGATCGGCACAATGGTTCTC
AGTGCGCTCTGCTCCCTGGTACTCGCCGGCATGGTGACTTATCTCGATGCTGGCAGTTTCGGTGATGGCTTTGAAGGTCACGGCTGGAAATGGGCGGGTA
CCATCGTGCGTGCTGGTGAGGTGGTGACGATGCCCGTGGTGGCGCTCATCGGCTTCTTGGCGCAGCCTCGCCTGAACTACGCGCTTGCTTGCGACGGACT
TTTGCCACGTATCTTTGCTGAGGTGGATTCCAAGGGCAACTTGTTCAAGAACACGCTCATCACGGGTCTGTTCTTCACGGTGATTGCCATCGTGGTGCCC
TTCGATACCCTCTGGGACATTGTCAATTTCGGTGTTATGATGTCGTTCATTATTGCCAACGTGTCGCTGACTTTGGCGCGTATGAAGCCGCAGTCGCCCA
AGCTTTCTCCTATCCTGATCGCCGCGCTCGTTGTGACGGCTGGATGCACGGCCTTCCTGTACCAGGAGGGATACGAGAACAATGCTTCGACTGCGTGTCT
TGTTTTCGCTATTATCTTCCTCGTCATCACCGTTGGTATCTCGGTGATTCTCTTCGTCAAGTGCCCGCAGACAGCCAATGCGCCCGGTTTGTTCGCCGCC
CCGCTGGTGCCGTTCATTCCGATGATCTGTATCCTTGCCGACTGGTACATGATCGCGCAGATCGACCACTTGGCTCTGGGTCTTAGTTTCGCCTGGATGG
CTGTCGGCGCGCTCTCATACTTTGTCTACGGATACTTCCATGCCGAAGCACGCGACAACTGGAGCCAGTTGATGGGTCAGAGCCTTCCCTTGCACGGAGA
CAGCCTCTCAGCACCCATGCTCTCGGCCAAGTACTCTTCGGTGCAGGACCTCAAGTCCCCCGCCGTATAGGTAGTTCTACGTGGTAA