Description :
From Genome Similarity Track
Location :
Scaffold_2:535442- 538255
Transcript NameFunction/comments
Physo_438188Hypothetical protein
Physo_253722Hypothetical protein

Sequence
2813 bases(100 bases per row)
AAGGTGGCTTTCGTTCCTGTGGCTTGGCCGTACTGTTAGCCGCAGGTTTCACAGATGAAACTGCTTTCGACGAAGGCTGATGACTCACTGCAGGTTTTAC
CGATAGCCCTCCATAGTGAGCAAACTCAAAGTTCGTTGCAATCTCAACGACCTCATGTAAAAACCTTGGACTGAGTTCCTTCACCTTCTTAGCCGTCTCC
GCACGAAGCCTATTCTGGAAGTAGAAACGCTTCTCCATTTCCGAAATGTCCAACTCGAATTGAGACATCAAATCCTGAAACGAGGACACGTATTCATGGA
TAGTTCCATGTTGTTTCAGTTGAAACAACCGCTCGCGCAGGTTGTATTCACAGTCTTTAAGGCAAAGTTGCGCGAGCGCAACTTTGCCTTAAACAGTTGC
CATGATTTCAGCATCCCCGCCGCATCACAATCCGACGAAAAGGCACAATACCAGTTCTACACATTTAGGATTCCTATTGGCTGAAAGCAGCATCTTTTAG
TCAATGAGTGACTTGCATGTTAGCAGAATCCTGCCAACCAGCCGTTGGCAGATTCCTATCTTAGAATATTACATTTAGAGGAAGTCAGAAACATAAAACA
AAAATAGCACTTCTCATCTTTTACCAAAACCCGCTACTTGGAGTCTTTATCTTGTTTAAAGTATACTCTTGGATCTCGAGTATACTTAACTCAAGTAAAA
AAAACCTACGCTTCCTCATACACGTGCGCATACGTGTAAGCCGTGGTAGTGAGCCAAGGTAGGCCCATTACACAGCTGAGTCAAGCGCAGCTGGACATGC
GCCTGAAGATGCAGCGTAAGCTGCAGAACGCAAGCTTCGAAGTCCGCGTGATGAAGGAGGAAGTGTCCCGGGCTCAAGCGGAGAAGACTTTTGCTGAACG
CGCCTTCGCCCAAGCTGAAGCCGCTCGTGTAGAGGCTGAACGCAGATCGCGTGAAGCTGAATGGTACCCTGAGGTCCCAGCCTACTCCGGCCCAGTTGAA
CCCGCGGACTATGCGGCAGTGCACGAACACCACCTCTTGCGCGCGCGTTCAGACGTCGCTGAAGTGGCGACCAAGCTCGCGAAGCAGCAGTACGAATAGG
ACCGGGAAGACCTTGAGCGCCGCTGGAAGGAACGCCTGAACGCAGCCGAGGCCAAGCTTCAACGCGCTGAGGCTGAACGCGCCAGCGCCGAATCGGAGCG
CGCTCGCCGCGCTGAAGAAGCCGACGGTGAGATGAAGAAGCGCTTGGACTCAGTGCAACGGACGATTCAGTACGTACTCTTGGAGCGGGAGCGAGAATGT
GCGGAAGGGAGTTGGAACGCGACACTGCGCTGAACGGCCAGAAGTTCCTGGCCGACCAGAACCGCGAACTGCGTGCAACCCTTTCCCAGGTTCAAGCTGC
TCGCGCAACTACGGCCCCTCAACCCACAACCGGAATCAATACTGAAACGTCGGCTGTACCTCAATCGACAACCTTGAATCAAGTATCCAGTGGTGCAATC
AATGATGGCGTGGCGCCCGGTACCGGTGATGTGCACTCCAAGAACACGACCGAAGTCGGTGCTGCCCAGCTACATGCGACCGTGGGTACGAGTCTGCCGA
AGAAGGAAACTGCCGAACAGGACCGAAGTTCCCAAGGGACGAAGACTGTGACGACGACGAAGAGCTCTGCATCCAAGTCGGAATCTGCGACCAAGGGTTC
AGCGTCATCTGCGGCCAAGAAAAGTGCGGTCAAGAAATCTGCGTCCAGAAGATCCGCTTCCCGGAAGAGTACCAAGGAGGACGCATATTCGCCGTCTTCT
GACCCAGACGACTCCGACTCAAGCTCATCGGACTCCAGCGATGACGATTCAATCTCCAGTGACTACAGCAGCAGCTCCAGCGACGACTTCGACTTGGACC
TGACTACCTCGACGACGACCAAGGAAGGCACGAACGTTTGGCCGTATCGACCTTACATCAACTACAATGCGGTTGAGAAGTTCAGCGAGGATGCGTCCGT
GGAAGATCGCGTTGGTTGGTGGAAGAGGTTCATCGATATGGTTGCTCAAGGTTCCTGGCCGGACAAGATGAACATCCGCCAGCTTCAGGGACGAATGGCT
TCGTCGCCTAGGGACTGGTACGCTCAGCTGCCAAAGTCCACCAGGCACAACTGAAAGAAGCTGTCTCGTCGGTTCAAGGTCATGTACTGCCGTACGACTG
GTTCCTACTCTGAGCGCTACTACAGCATGAAAGTGCGTTCAGGCGAGACTCCACGCAAGTTCTTCTACCGGCTGAACGCAGCTGCGGTCAAGGCTGGGAT
TGAGTTCCAGAAGTCATCCAACGACACCTTCGTCGTTTCATCAAGAAGCTGAAGGATACCCAGCTGAAGACCGCGCTGCAGGGACAGAAGTTCATGAATA
TCAGCGAAGTCGAGCATGCGTTCAGACGCCACGAGGACATTTGGCGCGAGGAAGGCTATGACACTCCCCCGCCACGACGTGACTTCCGCGCTGACAATGA
CCCGCAGGGCCGTTTCAAGGCTCGCGCTTTTGTCGCTCAAGGTTCAGAACCCGATTCAGATTCGGAGCCTGAACGGCGTGTCCGGTTTGAAGAGCTAGAT
GATGAAGTCAAGCCAACCGCTCAAGTGGCGCTCGTCAAGGGACGTGACGAGAGTGTGAGTGAACCTGTGCCAGCTGAAACGCAACCCGTGTTCAAGGTGG
AGAACATCACGAAGGAAATTTACCGTGTTTTGGATGCCGAAGGGTGGCGTCCTCCATCTCAGTTTGGAAAGGCGGATCTGCGTTCAGGCAACCCGGATCT
GCGTTCAAGACCA