Description :
From Genome Similarity Track
Location :
Scaffold_144:5353- 7409
Transcript NameFunction/comments
Phyag_g2685hypothetical protein PHYSODRAFT_467632
Phyag_g2686hypothetical protein PITG_03108

Sequence
2056 bases(100 bases per row)
CGTGGCTTAGCACCATATTCTCCATAGAAGAAACATGCACGTCAagccgagcttcttgcgcgcGCGGCAGGCGCCTAAGCCGAGCAAATGGACGTCGGAC
CATACAGGACAAGGAGGCAAGTCTTCCAtgggcgtgctgctggattggCTGGCGACGCAAGGCAACTACGagcgctggagacgctgcgccagAGTAGGAG
AGAGCAGTCGCCCATTGgccgacgagatcgtgcgactgctgcaggccgAAGGACTGACGAACCGCTCGGCCCATGAGGTGCAGAGCAAGAtggccgagct
ggagcagtcgTACCGAGAGGCGGCGGAGCgattggccagcgccaagcgAGAGGTGCAAGCGGCCCAAGGGACTCCGGCTGAACGCAATTTGCGTCGTGTG
CTGGAGCGCCACTGCCGCTacttcgctctgctgcagcccaTTATGAAGGATATGGGGGATATGGTGGCGGAATCGCCGGTAGCAAAGAGGCCGAAGCTTA
GtacgaagaggaagacggcgCCTGTGGTGAAACAATCTGTGcctgctgtttctgctgtgtctgttgctgctgcgccagcgtcgccgcctcctgctcgtgc
tgctagCCCTCCACCTGCGAGATTTCGGTCACCGTCGCCTCCTCCGGCAAAGAAGAGGCCGCGCTATCAACTGCGGGAGCGGCGCGAGGCGGAAGACTTG
GCCTGGGACTTTGACAATGAGTCTGTGGGCGGAATCAGGAGTCCAGGGACGCCTCcaacgccgtcgacgacgcgGCCAGtgaggaagagcaagagTAGAG
CGATGGCATCCATGTCAGGGATGcacatggaggaggaagaaggagaccgAGGCCATGctcgacgccagcgacggAATATCCTGCCTGATCCAGTGAAGAA
ACGTCAGAGTCCGATGCTGCGGTcgatcgacgagatcgacTTGGAAAAAGCTCGAGTCGAGCTCACATTGAggcagctggagctgcaaatGGCGCGCGAC
AAAGCGCTCGTCACTCGCGCGAAAGCTCGTGCGCAATTGCTGGAACAAGGTGTGTCGCGGCGAGAGGTCGATCGCCTCATGCCGCTCGACGTCTGAACGC
AGGGCTGGAGAGCTTAGCCATGGCGAAGTGCATCAAACTGATCCCTACGACAGTGGGTTGCTGCCTGAAATTGTTGCTGACACGTTATGTATGATGCATG
CTGAAGCGAGAACGCCGTGCGTGCGGTTGGAAGTGTCGGCGTTGTGTTAAGCCCATTAAATATCGAGTTTCCGTGACTCGTGGTTCTATAAGCTACATGC
TGCGTCTGGGAATGACATGTCCGTCGTTGGACGGCGTCGCGCCCGGTGTTCTAGGTCCACCCTAGCATGAGGAGTGGGAGCTGTTGGGATTGTCCAGCAC
GGAGCGAAACGAAGCAGTGCAtgcatgtcgtcgtccgtgatCTGGGGTACTACGAATGTAGTCTGGTTGTCCTGTGGAGGTGGGTTGTCTGCTGGTTGCT
TGCTTCATCTAGGCCTGAACCGGGAACGTGCGCtgcgagagcagcacgatCAGCTCGAGCTTGGAGATCGGAGACACGTCGATGGGGCTGCGGTCGACAG
TGGGGTCGGCGCTGCCGATGATCTCCGGGGCCATGGCGAACGACACGCCCTTGCGCGCTCGGCGCGGCGGCTTGGCCATCATGTCCTTGCTGACCCAGGC
GCAGTCGCGCGGCCGCTCCTGCTTGGCGTAGAGCGCGCGGAGACACTCCTGGCGGTAGTACTCGGTGAGGCAGGCCTCCATCTCCGATGCGCAACGCTTT
CCGAGCATGTTCGGTTGGTTGTGTGAATGGATAGCTTCGGGCGGAGGCGGTAAAAGTGCAACTGGGACGTTGACGGCGAATTGCACACTGCCGAGTATTT
CAGCCGCCGCTCGGTCGCATCGCCCGTCCTGTGTAGCGACTTGCCGACCAGCGGTCTCGTCGCTTGTGGCGCATACGGAGACTTTGCTTCCAGCCGCTCG
CGTCGAACGTGCTGAGACTGGACTGGGCGCTGTTACTCGCTGACGCGGCGGTCTCC