Description :
From Genome Similarity Track
Location :
Scaffold_697:5353- 7110
Transcript NameFunction/comments
Phyta_totarag10223hypothetical protein

Sequence
1757 bases(100 bases per row)
TTTCGATCGCATGGACAGTTTGGCTCATTATCTTGACCGTCGCACCAAATGATATCGCCAACTACCTCACGAAGACAAACGTGTTCGACAATTCTGGCTT
ATCATTGACCATGATCCCGTATTCTTGACCATCAGCGTTTTCAGTCTGGGGGTCCTTGTACTCGTATACGTCGATgtgttgatgaagatgactgTGCAGC
GAAATTCTGTACACCGCGTGAGGCCGTTTAACTGTTTACGCAACACGTTGTGCCCTGGGAATAGATCACGATTACAGGTTGAGCAAAATTTACTCAAGTT
CTGGTACGAGCTTACTGCTTTCAACGGGAAAAGACGAAAATATTGGGTAAgacgtacttcgaagtgccATTTATCGCGTTATGGTGCACTACAGCGTTAA
TCTAACCTATGCTACTatttaaaaaataaataaataaataaaataaaattgCTAGAGAACAGTCCTGATCTTGCAATTGAGGTAGCTGCTCTGTATCGGC
TACTCGAAGATGGCGTTCCAGCACCTTTGTGCTACGCTTACGCTTGTGTAGTTGCCGCAAACTCCCTTTCATGTGCGGTACTGATATTGAGGCCTGGTCG
CTACTCTGCCTTGTCAGAGGTCTTCGTGGATTCCTTGTCCGTATTATTGTGGTTCCCGTGCTCTTAACTCTCCACTCTGACGCTGATACTACTAAACTAT
CTTACATTTGTTTTCATTGGAACAGCTTTTGTGACATGATGGCTGACCAATCCTTTGGTTGGGCTACTCAGTTAGGTACTTCGAGTTCGATCGAGCAGAG
GCACTTTTGTATTTGAAAGTGTACCTGATCGGATGGTTCGAACGCAAAGCGCGACTCATGGCTGACGCCTCCAACGTGACTCTTTTCCAGATCAGTTTCG
ACGCACTGCGGATGAAGTCAGAACCTGATCTGTGTCTACGATGGTTATGAATTCACCATTTTGCTACCGACTAAAGCGAGTGTTGAATATTTAATacgcc
agcgacgtcgagcaTTGGGCCAGACTGCCTCCTCGAGCGTTGTAAAGATCGTCAACCAGCTCAACCTCTCTCGACCGATTTCGGCActttttgttgctgt
gagTGTTAGCGTTTTACTGAGCACTCACGCGAGTATTAACACGTCGAAAGAAGTAGTTCCACAGTTACGTATGCATACCGGTGGAAACTGCACGACTCGT
GTCCATGTCGGGCACTGATCGATGTTGAGAGAGCTCCTCGAATTTATGGCGAGTGGATTCATCCTCCTGACGTGACCAATCTTGTCAAAAGCTAAGTGAC
TTCGGGGGATTTACGCACTATCCATATTATCAACCGCCAGCTCTCAATTTGGCCGGAGGAATTGCAACGTTGCACAGACCTTCGTAGCATGTGAGCTTTA
CCTTCGATGTGGCATTGGTTGACAGTACAATGACTAATGAATGTTGCATCGTGCGAGGCAGAACCCTGATGTACACGAATATCCAGGAAGTTCCAGAATG
GGCAGCCAAATTCAACAACCTCGAAATGTTGTACGTCAAACTTTGGGACCTCTTCGATATTACGAGGACCCTAAGTCTAACTCTGTAACGACTCTTGCCG
atacaacagcagcatcgaaggACGTCCTATCGAAAACAATTTGATCTCTTTACCAGAAAATCTCTTCGACGGCATGTCGAAGCTGACATATCTACACTTT
GCAGTGCATCAAAACCTGAATAGGCTGCCGCCAATGGATGGATTAACAAACTTGAAG