Description :
From Genome Similarity Track
Location :
Scaffold_2:535222- 537242
Transcript NameFunction/comments
Sapdi_VS20SDRG_00797peptidyl-prolyl cis-trans isomerase B
Sapdi_VS20SDRG_00798hypothetical protein

Sequence
2020 bases(100 bases per row)
GTGAGCGCAGCTCGTCCTCGAGCCTCGGCAGCATCGGGCTCATCGGCGGTCTCTTTATGAGCGGGTACTTTATGGGGACGTACATTGGCGTCTTGCCGTC
GTACGAAGCGCTCAAGCAGCAGCTGGGCTTGGCCGAGCCCACGTCGGCCCCGTACACTGGCAAGGTACAGCGTTGCTTCCGCATTTGGCCACGATTTGTG
ATGCGCTGGTACTAGCTCGACGTCGAGTCCAAGGTCTTCTTTGACATTGGCATCAATGGCAAGCCATCGGGCACGATCGTGTTTGGCCTCTACGACAAGG
TGCAGCCCAAGACGGTCGCCAACTTTGTGGCGCTCTGCACCGGCGACCGCTCTGTGAACGGCACGGCGCTGACGTACCGCAACAGCCGCTTCCACCGCAT
CATCCCCAACTTCATGTTGCTCTGCGTCTTTTTCGAGGTTGATGCTACTGGATACATAGGATTCAAGGCGGCGACTTCACCAACGGCAACGGCACGGGCG
GCCTCTCGATCTACGGCGACCGCTTCGCGGACGAAGACCTCTCGGTGCCGCACGCGGGTGCCGGCACGCTCTCGATGGCCAACGCGGGGCCCAACACGAA
CGGGTCGCAGTTCTTCATTTGCACGGCGCCGACACCGTGGCTGGACGGGAAGCACACGGTCTTTGGGCGCGTACTCGAGGGCATGGACCTTGTCGAGAAG
ATCGAGGCGCTCGGCACGCGCGGTGGGCAGCCCAAGGCCGAGGTCCGCATCCTCAACTGCGGCCTCGTCGAGACGGCGCATGACCAAGCTGCTGCCACGA
CGACGCCGACCGTGCCCGAGGACGTGGCGATGACCGAGCGGCTCGAAGATCTGCGCGAGATCGAGGCCCAGCTCCGCGCCAACAAGGCGACGATCGACGA
AAGCATGTACACAAACATGCTCCACGACATTACGGCCGAAAAGTTGCGTGTCAAGAAGGTGCTCAAGGAACTCAAGCAGCGCAAGTAAACGAGTTGGCTA
CAAACACACAAGACGATTTTGACCATTTTCAAACACCCTCTTGCCCGGTCGGCAAGGGTGCGTCGGTGTGCCCAGGACGGCGATGTACTGGTCGGGCACC
GTGGGGTAGGGGAACGACGCCAGATCCGACGCTAAGCTTGTTCCACGAGCAATAGACAGTAGGGTAGAGGAGGTAGATGCTATATACGGAGTCGTCGAGA
TGGTTAATGTGGTCATGCGGGATAGGGCTAGTAAGGACTACACATCGACGAGCGGGTGCAATGGCTTGAGCGACGATCGATTGGTGTCGTCCATGCCCGG
GCGCGCGGGCGACGTGGCGACCGACGCCGGGTTGTGGAGGTTGGTGAGGAGGAGGCTTCCGTTGCTGCCGCGGCGCGAGTAGAGGTCGTTGCCGTTGATG
ATGGCCGAGTACGTCTCGTCGGCATAGTTGCTCGTCGCAGGGGCGAGCGGCGCCGAGTCGGCGCGGGTCGCGGACCGCGCGAGGTTGCTCGACGACGGGT
GGAACTGGTGCATCTCGGACGACCGGCGCTTGTTGGTTTGGTAGTTTTCGCGGTAAAACTCTTCGTCCTCTTCGACGTTCTCGTGGCGCTCGATGCGCTC
GCGGTTGGAGCGCCAGAGGCAGCAGAGTGTGCAGAGCACGCCGAGGATAAGGACGCCAGAGCCAATGATGAGGCCAATCTGCCACGTTTGAAGCGCTAGA
GCCAAGTTATACAAGGCCGGCCCAGTAAGATGTGGACGTACACGAGCCGTTCGAGTCGGGAGACGGCGAGCTGGAACCTGGAGGAGTCGTCGTGGGTGTA
GTGGTAGGCGCCAAGGTGGGAGGAGCAGAGGTGGGAGTGGCAGAGGGAGAAGGAGTAGGTCCATCAGTCGACACGACGGGTGTAGTGGCTGGGGACGTTG
TACCTGGGGACGTACTCGTAGTGGGGCTCGCCGTGGACGGCGTCGGCTTGGGCGACTCGGTGGTCGGCGACGGCGTGGGGGCCGGCGTCACGGTCGTTGG
CGCCGGTGTTTTCGTGCTCG