Description :
From Genome Similarity Track
Location :
contig_29:535199- 536990
Transcript NameFunction/comments
g6871.t1hypothetical protein

Sequence
1791 bases(100 bases per row)
CACTATACCACCTCGAAATGTTTGGTTTTGCTTGCGGAAACTCTATTGCTTGTCGGTAGTGCTCCACATTCAAGTCATAACAATTTGTTTTCGCTACTTC
TTGCTCCGAGGTCATCCCCTCACGTATCGAGTGAACCATAATCAACTTGACTATTGTGCACCACGCGGACCCAGTACAACACACTCTCATTGAGTGCGCG
TGATGTGATAGCGTCGTATATCAGTGTTTTTTGCTAACCAGCGAATTGTGTTCTTCGGTCACTGTCCTCATCGATAAGAAAGTTCAGCGAGAAGTTGAAA
TCGAGACGCTTGCCTAGCATGCGTTCGTATAGAAGGCCACGACCATCTTCACTGTTGCGTCCACAGATGGGCTTTTCCAAATGAGGAAACGCGTGCCGCA
ACGTAAACTCTGTTGTCGTCATACTCAGCTTCGCACGGGCAGTCATCACGACAGGGGCCACGGACTCAATCCTTTGGAGCTTCATCTCGGTTCTCGAGAT
CGAATGCGGCTTCTCTGCCGTTGATCCACCGACTTCGACGCCAGTTAATGAGAGCAGAGCGTCCCCGGCAGCACTGTAGTGGTCGTGGATCGGCGCGCGA
GGAACCTCGATTTGTATGGATGTGTACGGACTAACTGCCGCCTGAAAAGGCGTAGCGAGACCCGGGCCGTCGTTCTGGTGGCGGCCTGTGGGTGCGCGCG
GGTGCACAAGACCCACGAGGCTGTCGCTCAGCGGCCTGGGTGCGAGGGGATAGCGGTTCGTGCTGAGTGCGGCGGGGAGTCTTGGTGTGGTTGGCGACTG
GTGGGCTGGCTGGGAGTTTCTCTTGATGAAGAAGCACGTGCACCCACCACGGTCAAACACGTCACGTTCAACCACATCTTACACATCAACAACGTTCTCG
TCCTGCTCTCCCGGGGAGTTCATTTTCATTTCTTCCTCGTCCTCCTCCTCCTCTCCCGAGTGGTGCATCGTTTCGTCTAGGGTTTCCCCAAAGTGGACGG
TGATAAATCCACCGGAGAAAAAAAATAATATGCCGGACATTCCTAACCCTATCGTAAACAGTCATATGTTTATCGATAGCGCTGAAGAACCGTATGAAAG
AAAATGACGAGGATAGTGGTATTTTTTAGTAGTTGATGGGTGACAGAACCGTAGTTTACCATCACGTCTTATCTAAATTCTGAAAAGTCTGTACGGTATG
CATACGGTACAAGTGGCAGGATATCATACCGGATTCTGAACATGGTGTACCAAAAGTTATTTTTAAGTATCTGATAGGTTCATGAAAATACCCAGAAGCT
TAATCGACGATCAGTGCGAGCGCTATATGCCAAGCAAGAATTGAACTTCCTCGTTGTTTCTGTGTCCTTAACTCTGGTCCCCCTCAGCGTCACACGCACA
GTACCGCACGTAACGTAGACGGTAAAACTGCTCCATGTCGTAGCACGCTTCATCCCACTTGTGGCCACTCAACATCGATTCTAAGAAGAATAGACACCAG
TTTCCACACGAGTGACCACCTTTTTGCTTGCACTCGATCCATCGCTCAAATTGAACGACCTGACACTGGCCACCAAGCTGCCAAATGATTGCATCTCTCA
CAGCCTTCTCCAAACCTGTGTAATGTGGCTCCAACTGCTGCGGGTCAAACAGTGTACACTTGACTGGATTGCTCGTCAAGTCGATGAAAAACGCCAGCCA
ATGGAACCCTTCGGGATTGACAACGCCAATTTGACACTCAACCGCTGCATGGAAGGCACCGTTGGAAGCGGCACATTTCCTCTGTCTTGGT