Description :
From Genome Similarity Track
Location :
contig_29:535123- 536971
Transcript NameFunction/comments
g7201.t1XP_008891538.1 hypothetical protein PPTG_02249 [Phytophthora parasitica INRA-310

Sequence
1848 bases(100 bases per row)
TCGTCCTAGGCTCGTTGAGCGGGCGCGGCTTGTCCAGGAGCAGAGTCGCATGTGGAAGGCGACGTGTGGGATGCAATTATGAGGCACTATACCACCTCGA
AATGTTTGGTTTTGCTTGCGGAAACTCTATTGCTTGTCGGTAGTGCTCCACATTCAAGTCATAACAATTTGTTTTCGCTACTTCTTGCTCCGAGGTCATC
CCCTCACGTATCGAGTGAACCATAATCAACTTGACTATTGTGCACCACGCGGACCCAGTACAACACACTCTCATTGAGTGCGCGTGATGTGATAGCGTCG
TATATCAGTGTTTTTTGCTAACCAGCGAATTGTGTTCTTCGGTCACTGTCCTCATCGATAAGAAAGTTCAGCGAGAAGTTGAAATCGAGACGCTTGCCTA
GCATGCGTTCGTATAGAAGGCCACGACCATCTTCACTGTTGCGTCCACAGATGGGCTTTTCCAAATGAGGAAACGCGTGCCGCAACGTAAACTCTGTTGT
CGTCATACTCAGCTTCGCACGGGCAGTCATCACGACAGGGGCCACGGACTCAATCCTTTGGAGCTTCATCTCGGTTCTCGAGGTCGAATGCGGCTTCTCT
GCCGTTGATCCACCGACTTCGACGCCAGTTAATGAGAGCAGAGCGTCCCCGGCAGCACTGTAGTGGTCGTGGATCGGCGCGCGAGGAACCTCGATTTGTA
TGGATGTGTACGGACTAACTGCCGCCTGAAAAGGCGTAGCGAGACCCGGGCCGTCGTCCTGGTGGCGGCCTGTGGGTGCGCGCGGGTGCACAAGACCCAC
GAGGCTGTCGCTCAGCGGCCTGGGTGCGAGGGGATAGCGGTTCGTGCTGAGTGCGGCGGGGAGTCTTGGTGTGGTTGGCGACTGGTGGGCTGGCTGGGAG
TTTCTCTTGATGAAGAAGCACGTGCACTCACCACGGTCAAACACGTCACGTTCAACCACATCTTACACATCAACAACGTTCTCGTCCTGCTCTCCCGGGG
GGTTCATTTTTATTTCTTCCTCGTCCTCCTCCTCCTCTCCCGAGTGGTGCATCGTTTCGTCTAGGGTTTCCCCAAAGTGGACGGTGATAAATCCACCGGA
GAAAAAAAATAATATGCCGGACATTCCTAACCCTATCGTAAACAGTCATATGTTTATCGATAGCGCTGAAGAACCGTATGAAAGAAAATGACGAGGATAG
TGGTATTTTTTAGTAGTTGATGGGTGACAGAACCGTAGTTTACCATCACGTCTTATCTAAATTCTGAAAAGTCTGTACGGTATGCATACGGTACAAGTGG
CAGGATATCATACCGGATTCTGAACATGGTGTACCAAAAATTATTTTTAAGTATCTGATAGGTTCATGAAAATACCCAGAAGCTTAATCGACGATCAGTG
CGAGCGCTATATGCCAAGCAAGAATTGAACTTCCTCGTTGTTTCTGTGTCCTTAACTCTGGTCCCCCTCAGCGTCACACGCACAGTACCGCACGTAACGT
AGACGGTAAAACTGCTCCATGTCGTAGCACGCTTCATCCCACTTGTGGCCACTCAACATTGATTCTAAGAAGAATAGACACCAGTTTCCACACGAGTGAC
CACCTTTTTGCTTGCACTCGATCCATCGCTCAAATTGAACGACCTGACACTGGCCACCAAGCTGCCAAATGATTGCATCTCTCACAGCCTTCTCCAAACC
TGTGTAATGTGGCTCCAACTGCTGCGGGTCAAACAGTGTACACTTGACTGGATTGCTCGTCAAGTCGATGAAAAACGCCAGCCAATGGAACCCTTCGGGA
TTGACAACGCCAATTTGACACTCAACCGCTACATGGAAGGCACCGTTG