Description :
From Genome Similarity Track
Location :
contig_104:53512- 54928
Transcript NameFunction/comments
g13553.t1hypothetical protein

Sequence
1416 bases(100 bases per row)
TGTGACAGGCCTCTGTCATACGGGTGCCACCGCGTGTGCGCGGTGGCCAATCAGAGTCGAGCGTACAACCGTTGGTTGGGACGGTCTCGAGTCTCGACTA
CTGCATGTCCACATCAATCAATCAGAGTTCATTTTACCTACTTCCTCGCAACTACAGTGTACGTCGGTAACGGGTTCTGTTAGCCCGTTACACCTGGTAG
CACTTCGTCGTCCGTTCAACGCCCAAGATCAAGATGAACGACATCTCGAGTATGTCGTTGGAGCACGAGAACTTCCCGCACCTGACGCTGATGGAGTGGG
AAGCACTCCACCGCCTGGCAGCGGTGTCAGGCGACACGGTCGTCAAGACGCTCCTGACGACTGGAACGGAACACGAACAACGCTTGTGTGCTCAAGAGTT
CTTAACGCGTGAGCTCGCTGATCTACGTCGGCGTGCGACGACTCCCACGCCGTCCAAGAACAAGACCGACATCGTCAAGCTCGATGTCTCCACATACAGC
GGCGAAGGCAAGACCCGCCTTCACCTGAACCGCTGGTTCTGCGAGGTGGACATAGCGATCGAAGCTCGGCAATTGTCTACCGAGCTCGCGCGCACGCGCT
TCCTGCTTTCCAAGTTGTCCGGGAAGGCGAAGGAGTGGGCGCTCGGCCGACTCGTGGCCGACGCCTCCTGCTTCCCGACGATGGCAGCTATGCAGGCTGA
CCTGCGACTCGCGTTCGAGCCGCCCCAAGATGAAAGCGTTCAACGGTCGGCATTCCTTTCGCTAAAGCAGGGACGTCTGACCATGCTCGAGTACATTCAA
CGCGCGCGCCATCTCGCCTCGTGTATCACGACGCAGCCAGTCGACATGGCCACACAAGTCCACGTCTTTGTCTCCGGTATGAATGCTGGCTACCAGCGCT
TCTACTTGACCCGCAAGACGCCATCGACGCTGGAGGAAGCCTTCACTGTCGCTTTGCGTGAAGACTATAGTGTGTCGGCATCGCAAGCTTTCGATGTCTC
ACGGCCTCTTGTCCCTGACCCAGAGCCCGAACCCATGGAGGTGGATGCTATCCAGTCCTATCGCGGACGTCGGGAGCCGACGTCGCCTTCACGCCAATCC
TCCACTCGGGGGTCGCGTCCTATGAAGTGTTTTCGATGTGGCAAACCTGGCCATCGCGCGGCGGTGTGTCGTGCTCCGTCGCCCATGGCGGCGAACGCTA
CGACTGCGAACGACGTCGCCGCTCCAAAAAACGGCGACGACCAGTAGGTGCGGGGCGCCCTACTGGGTGTGTACGGAGCGATGGTTCTCTGGTGGCAGAA
CCTCCTCCTAGCCCTCCCGTGCTTCACGCACGCCTATCAGCCACCACATCTGGCAGCGACTCGAGACTGATCGTACTCAGTCTCCACGTTGAAGGTGCAC
AGCGCCCAATACGCGC