Description :
From Genome Similarity Track
Location :
Scaffold_2634:535- 2994
Transcript NameFunction/comments
Phypl_g15271reverse transcriptase

Sequence
2459 bases(100 bases per row)
CCACTCGGGCAACTTCCACAAGATCGCGCTGtaggcgccgccgccgcgcttaACAGGGGCTGATCAGTCAAAGCTCACCACAAACAGCTCCTCGCCCGTC
CCCACGGTCGGGATCGGAGCTTGGATCTTACGTCGTGGCTCCTTTTTGGGTGCGATCGCAgtcagcgcctcgtccaccttggaTCGGGGCGTGATACTCG
CTGCGATCGCCCCTAGAATCTCGTCTTCCCCTTTCACGCACTTCACGATCTCGAGCGTCCAAGGTGATAGGAGAGCGGTCCACTGTCCAAGACGTCCCTG
GAACCCCGGCGATTTGAAGAGCCATGCCAACGTGGAATGCCTAGTCAAGATCCGAATCTGACGTCCCACCAGCATGTTGTAGTTCAGATCCAAGATCCTC
AAGAGGATCAATacttccttctccaccacgtttTAATTCAACTCATTCGACTTGAGCGTTCTGCTTGCGAACATGACAGGGTGGTATATTTGTTCGTGAT
CTTGCACTAAAGCCGCCGAGATCGCCCACTCACTGGCATACACGATCACCACTGCCTGGCGATCGGGGTCAAAGTGACGTAAGATCGGCGTCGTGGCTac
cttcgccttcagcgtctcgaagGCCTGTTGCGCTCGAACCCATCTCTCATCCGCGGCCTTCGATCCCGGCATTACGGGGTCCGATCCGGTCGTGTTAAGC
GTCCTGGGATCGGGATTCGTGGGATCACGGTCAAGCAACGATCGATCCAGCAACTGACGGAGATCTCGCCGCTTTCGCAGTTCAGCGAAGTCCACCTCAC
GTAGCTCGTACAGGACCGCGGCATAGATCGCATAGTCCTCGATGAAGCGGCTATAGTAATTCAAACTGCACAAGAACGACTGCATCGATCGGAAAGATTC
CGAAAAATGTCGATCAGTCAGTGCTTCCAGGTCTTTTGGGCGAGCTTCCAACCCACCAGGTGACACTTGGTGTCCCAGATAGTCCACTTTGTCCAGCCCC
CCAAAACTCTCCACCATGCTGATAGACAGATTCCACTCGTAACATGCGTCCAACAGATCTTCCACTCGATCGCATAGCTGATCCCACGATTCGGCAGTCA
CCAGGATGTCATCGATGTATGATCGACGTCCCAGCACTGACGGTTTACCCGGATCGACGGGTTCGCCCGCAAGTCCGTCAGCTGTCCATGGTCGCCCGAG
CGGGAGATCTTCATAAACCCATACAACGCGTTATCCACCAGTCGCTGGTAGATCTGCGGTGCGTTCTTGAGACCGAACGGCATTCGGTTCCACTCGAACA
GTCCAAATGGAGTGATGAAAGCCgagctcgctcgagctcggtCCATCTTCGTGACCACCCAAAACTCACTAGCCATATCCAACGAGCAGTACCATAAGAA
CTCGTCCAAGCCAATCGTTGATCAGTGGCATCGGATAAACCATCAGCCGCGTAAGTCCGTTCACCAGTCGGTAATCAATGCACAGCCGCATATCCACTCC
GTTCTTCTTGATAATGATCACGAAGGGCTACGTCGAGTGTCTAATGATCTTGGCCGCCAGAAGTCCCTTGAGCAGATCCGACACCTTCCCTCGGAACTGC
AGGGCGATCTTCCGCACCCGTTGCGCGATAGGCCTTGCGTCACCTACGTTGATATCACAAACAACGCCTCTGGCGGCTGGGGGCAACGCATTGCCCTTGC
CGATCAGGAGGTGTCGCCTCTTCCAGATCATTCGACGTAGCCAGTCAATCTTTTCAGGGGTATTATGCTTCGGATCTCCCACTTGAATATCTTCGATCGT
CACTTCGTCCGTCGCGTTGGAGCTAAGTTCCGGAAGCACAgccagctcttcttcgacatcTTCGGCCAAAAGTCGCTTCCTTCATGATAGAAGATCGATC
CATCGCCTGACGGGTCCTCTGTTCCGACACGTTCTTGATCCGGTCGGTCTTTTCTCACCGTGTGGTCCTGAGTTGAGTCTTGATCGCTTACCACATTTTT
GGCAAGTCAAACGTTTCCAGCAGTCCAGGCCCGTATGCTTACGGGAACCACAATACAAACAGCGACTGCGATCCGTcgggaggcagcagcgatctGCGAC
CATGGGGCACCTGATCTGTCGCGATCCAACCCGGTGGTAACCGATCTGCCTGGGCTGTCTCGCTCCCTGCCGGAGGTGGAGTAGCTTCTGCCGATGCAAG
GTAGATCCGACGTAGATCGCCCTCCGAATCAGATCCTCCGGATCCGTCCAAGCTGGAGTCCGATCCCGACGGAGGAAGCAAATACTGGATCGCGCGTACC
GCTCTCTTGGCTGGGGCGGCTGACGCAACTGCAGGGGACTTCTGTCGATACTTGGATCCGAAGGCAGATCACTTTTGTCTACTCTTCGTCTGTTCTCGAG
CTCGGAGGACTTCTTCCAACTCGTCAGCATCCGAAAGCCGTAGTAGCGTCAATTGGTCC