Description :
From Genome Similarity Track
Location :
Scaffold_864:535- 2232
Transcript NameFunction/comments
g12257.t1POM76356.1 Putative Glycoside hydrolase [Phytophthora palmivora var. palmivora

Sequence
1697 bases(100 bases per row)
GTGGGATCTTACCTTGGACTTCCATTATCGATCTTGGGTGAAGTCAACGGAACTTGGGGCTGGACGACGACAGAAATGCGAGCCTTCATCCACCGCATTC
AAGAAATCACCATGGAAGAGAACGGCGGTCACCCAATGATCTTCGGTGTGGATGCTGCTCACGGAAATTCACTTCTGTCAGACACGGTGTTCTTCGGTCA
CCAGATCAACGCTGCTGCCACGTTCAACCCGGACATTGCATACGAACAAGCTCGCATCACTGCACGTGATGCGCTAGCTGCTGGCATCCCTTGGGTCTTT
GACCCCGTTCTCGACATCGTACACAACCCGCTGTGGCCGCGCGTGTACGAGACGTTTGGTGAGGATCCGTACCTCATTTCCACCATGGGGGTCGCCATGG
TCCGTGGTATCCAGAGCTACAACGAGTCGGCCGCATGCATGAAGCACTGGATCGGCTACTCGTGGAGCGCGACTGGCAAGGATAAGGACGGCGTGGAGAT
TTCAGATTATGACCTCATGAACTCGTACTTCCCGCCGTTCAAGGCCGCTGTGGATGCAGGTCTGTTGACTGGAATGGAGAATTACATTTCCGTGAACGGT
GTCCCTGTGATCGAAAATACGAAGCTGATGACGACGTTGCTGCGCGAGGACCTTGGTTTTGATGGTTTGATGGTGTCGGATTATGGCGAGATCAATCAAC
TCACAGAGTTCCATCGTACTGCTCGCTCGACCGAAGAAGCCACCAAATTCGCCCTTGAGCGCACGTCACTCGATATGAGTATGGTAGGCAGGAACCAGGC
TTTCACGAATGCAACCAACAAATTGATTGAGGAGAGTCCGGAGATCATTGACCGCCTCAAACAATCTGTGCGGCGCATTGTCAAGACGAAGCTGAAGCTC
GGCCTCTATGACAACCCGATGCCTGGCGCGGAGTACGTTGACATGGTTGGTAGCGATGATGACGTCGCCGCCGCGTTAACTGGAGCTCGCGAGTCGATCG
TATTGCTGCAGAACAATGACAGCACCCTGCCTCTTTTGAAGAACGCATCAGTATTTCTGACGGGCCCCAGCGCACACAACATCGGATACCAGTGCGGTGG
CTGGAGTCTCCAGGTATGGGGAGTATCCGGTAACGACATGTTCTCACACGGTGTTTCGGTGAAGCAGGGCTTCGAGGTAATTGCTGCCAACGATTCGTTC
ACTTACTTCAACGGCCTGAATATAACGGGTAACTACACGGATGTGGATCTGGCGACTGCAAAGGAATACGCCAGCCAAGCCGAATATACGATCGCAGTCA
TTGGCGAGGAGCCGTACGAGGAGAAGTCGGGCGATATCGACGATCTCTCGCTGCCTGCTGGTCAAATTGAGTACGTGAAGGAGCTGGCATCGACGGGAAC
TAAGGTCATCGTGGTGCTGTTTGAGGGCCGTCCGCGTCTGCTGGGTGGCCTGCCGGAGAACGTGTACGCCATCCTGAACGGCATGCTGGCGTGTGAGCTG
GGTGGTCAAGCCGTAGCTGAGATCGCCTACGGTGATGTGAACCCGAGTGGCCGTATGCCTATCACGTATCCCAAGGACTCTGGCAACGTCATGATCCCGT
ACCGGCACCGCGTGACCACGCAGTGTGCGACGGGCGACTACTGCGAGCCACAGTGGACTTTTGGCCACGGTCTCAGCTACACTGACTTCACGTACTC